MotifLab User Manual

This manual will mainly focus on more in-depth explanations of the different parts of MotifLab. For a more practical introduction on how to use MotifLab, please take a look at the video tutorials. If you have any questions regarding the use of MotifLab that are not answered in this manual or in the tutorials, please do not hesitate to contact us.

Note that this user manual is still in preparation (last updated 2024-09-02).
Some functionality in MotifLab may not yet be documented here, and some very recent features in MotifLab that are documented here may not be available in the released versions.

Contents

  1. Introduction

  2. Graphical User Interface (GUI)
    1. Introduction
    2. Navigation
    3. Configuring the visualization
    4. Sessions

  3. Command-line Interface (CLI)
    1. Command-line options
    2. Data injection
    3. Whole genome analysis

  4. Data Types
    1. Sequence
    2. Feature Datasets
      1. DNA Sequence Dataset
      2. Numeric Dataset
      3. Region Dataset
    3. Motif
    4. Module
    5. Collection
      1. Sequence Collection
      2. Motif Collection
      3. Module Collection
    6. Partition
      1. Sequence Partition
      2. Motif Partition
      3. Module Partition
    7. Map
      1. Numeric Map
        1. Sequence Numeric Map
        2. Motif Numeric Map
        3. Module Numeric Map
      2. Text map
        1. Sequence Map
        2. Motif Map
        3. Module Map
    8. Numeric Variable
    9. Text Variable
    10. Background Model
    11. Expression Profile
    12. Priors Generator
    13. Analysis
    14. Output Data

  5. Operations
    1. Introduction
      1. Operation arguments
      2. A note on coordinates and orientations
    2. Conditions
      1. Feature Conditions
        1. Position Conditions
        2. Region Conditions
        3. Compound Conditions
      2. Selection Windows
      3. Subset Conditions
    3. Individual operations
      1. analyze
      2. apply
      3. collate
      4. combine_numeric
      5. combine_regions
      6. convert
      7. copy
      8. count
      9. crop_sequences
      10. decrease
      11. delete
      12. difference
      13. discriminate
      14. distance
      15. divide
      16. drop_sequences
      17. ensemblePrediction
      18. execute
      19. extend
      20. extend_sequences
      21. extract
      22. filter
      23. increase
      24. interpolate
      25. mask
      26. merge
      27. moduleDiscovery
      28. moduleScanning
      29. motifDiscovery
      30. motifScanning
      31. multiply
      32. new
      33. normalize
      34. output
      35. physical
      36. plant
      37. predict
      38. prompt
      39. prune
      40. rank
      41. replace
      42. score
      43. search
      44. set
      45. split_sequences
      46. statistic
      47. threshold
      48. transform
    4. Protocols
      1. Creating a protocol
      2. Executing a protocol
      3. The protocol language
        1. Flow control
      4. Protocol editor
      5. Display settings
      6. Macros

  6. Analyses
    1. benchmark
    2. binding sequence occurrences
    3. compare clusters to collection
    4. compare collections
    5. compare motif occurrences
    6. compare motif track to numeric track
    7. compare region datasets
    8. compare region occurrences
    9. count module occurrences
    10. count motif occurrences
    11. count region occurrences
    12. evaluate prior
    13. GC-content
    14. motif collection statistics
    15. motif position distribution
    16. motif regression
    17. motif similarity
    18. numeric dataset distribution
    19. numeric map correlation
    20. numeric map distribution
    21. region dataset coverage
    22. single motif regression

  7. Tools
    1. Mouse tools
      1. Selection tool
      2. Move tool
      3. Zoom tool
      4. Draw tool
    2. Data Browsers
      1. Motif Browser
      2. Module Browser
      3. Sequence Browser
    3. Interactive Analysis Tools
      1. Positional Distribution Viewer
      2. Region Visualization Filters
        1. Motif Score Filter / Region Score Filter
        2. Interactions Viewer
    4. Sequence Tools
      1. Sort Sequences
      2. Crop Sequences
      3. Extend Sequences
    5. Other Tools
      1. Update Motif Properties

  8. Configuring MotifLab
    1. General options
    2. Configuring external programs
      1. XML configuration files for external programs
    3. Configuring data tracks and sources

  9. Data Formats
    1. Feature Dataset formats
      1. FASTA
      2. 2bit
      3. WIG
      4. BigWig
      5. BedGraph
      6. PRIORITY
      7. PSP
      8. GFF
      9. GTF
      10. EvidenceGFF
      11. BED
      12. BigBed
      13. Region_Properties
    2. Motif formats (and module formats)
      1. MotifLabMotif
      2. MotifLabModule
      3. INCLUSive_Motif_Model
      4. RawPSSM
      5. TRANSFAC
      6. Jaspar
      7. XMS
      8. MEME_Minimal_Motif
      9. Motif_Properties
      10. Module_Properties
      11. HTML_MotifTable
      12. HTML_ModuleTable
      13. BindingSequences
    3. Background formats
      1. PriorityBackground
      2. MEME_Background
      3. INCLUSive_Background_Model
    4. Other formats
      1. MapFormat
      2. MapExpression
      3. ExcelMap
      4. ExpressionProfile
      5. ExcelProfile
      6. HTML
      7. Excel
      8. RawData
      9. Template
      10. TemplateHTML
      11. Properties
      12. Location
      13. Sequence_Properties
      14. Graph
      15. Plain



Introduction

MotifLab is a general workbench for transcription factor binding motif discovery and regulatory sequence analysis. MotifLab allows users to discover motifs and predict binding sites for transcription factors using several published motif discovery programs, and additional data (including for instance information about phylogenetic sequence conservation, DNase hypersensitive sites, epigenetic marks and ChIP-Seq peak regions) can be incorporated into the analysis to corroborate or disprove predictions. The results can be analyzed further to e.g. find motifs that are statistically overrepresented compared to an expected distribution or to discover motifs that are over- or underrepresented in one set of sequences compared to another set.

MotifLab allows user to create data objects of different types that can be manipulated and analyzed through the use of operations or examined with interactive tools.


Graphical User Interface (GUI)

Introduction

Navigation

Configuring the visualization

Sessions




Command-line Interface (CLI)

Sometimes a user just wants to run a protocol script to perform an analysis and produce a set of output files but is not interested in looking at the results visually. In such cases, it could be preferable to run MotifLab in CLI-mode with a command-line interface. Running in CLI-mode will be more efficient than running in GUI-mode, since MotifLab does not need to spend time- and memory-resources on data visualization and other amenities (such as e.g. undo/redo functionality). Hence, CLI-mode is the preferred mode when analysing very large datasets.

The following command will execute MotifLab from a command-line interface, such as cmd.exe in Windows or a UNIX shell:
java -cp MotifLab.jar motiflab.engine.MotifLab -p <protocol> [-s <sequences>] [optional arguments]

The -protocol argument (or "-p" for short) specifies a protocol script to execute. This argument is mandatory unless the -help option is used to list the command line options or the -config option is used to configure MotifLab.

If the protocol to be executed analyses sequence regions and no sequences are defined within the protocol itself, the -sequences argument ("-s" for short) must be used to specify a file which contains information about which sequences to analyze. This sequence file can either be in FASTA format, BED format, or Location format. If the sequence file is in FASTA format, the location and genome build for each sequence should preferably be specified in the sequence headers (as explained in the description of the FASTA format), since this information would be required in order to import additional data tracks from preconfigured data sources. Alternatively, a default genome build can be defined with the -genomebuild argument. Also, for FASTA sequence files, a DNA Sequence Dataset named "DNA" will automatically be created based on the information in the FASTA-file and this track will then be available for use in the protocol. If the sequences file is in Location format, a DNA track must be explicitly created in the protocol if this type of data is required, for example with the command "DNA = new DNA Sequence Dataset(DataTrack:DNA)".

All output data objects that are created with the output operation during the execution of the protocol will be saved to files after the execution ends. The filename for each such object will be based on the name of the object itself with a file-suffix which depends on the data format used. For example, an output data object named "BindingSites" which contains output of a Region Dataset in GFF-format will be saved to a file called "BindingSites.gff" (unless the -output option is used to specify a different name). If an output data object contains output in many different formats, the suffix will be set to ".txt".

Command line options

The following table lists all available command line options. Many of these also have an abbreviated form (which takes the same number of arguments as the unabbreviated form!).
If the value for an argument contains spaces it must be enclosed in double quotes. E.g.:  -protocol "filename with spaces.txt"
Option Short Description
-protocol <filename>-p Specifies the protocol file that should be executed. This argument is mandatory unless the -config option is used to change configuration settings.
-sequences <filename>-s Specifies a file containing the sequences to be analyzed with the protocol. The file can either be in FASTA, BED or Location format. This argument is mandatory if the protocol works on sequence data unless the sequences to analyze are defined within the protocol itself. MotifLab v2.0 introduced the "whole genome analysis" mode which allows a genomic region to be specified instead of a sequence file with this option.
-format <dataformat> MotifLab will try to determine the format of the sequences file automatically based on its contents and number of columns, but it is possible to declare the format specifically to avoid possible confusion. The allowed values for this option are "BED" (regular BED file), "geneID" (6 column format defining sequence segments relative to named genes) or "manualN" (Location format with N=4|8|10 columns). Alternatively, a custom BED-format can be defined with a list of comma-separated properties.
E.g. -format "chr,start,end".
-genomebuild <build>-b Specifies a default genome build which will be used for all sequences whose genome is not explicitly defined in the sequences input file. This can be necessary to include if the sequences file is in e.g. BED-format.
-newNames If two or more sequences in the input file have the same name, they will replace the previous sequence with that name. By specifying the newNames option, all sequences are assigned new names on the form "SequenceN" (where N is an incremental number) to avoid this potential problem.
-split <groupsize> If you have many sequences to analyze and not enough computer memory to store all the required data at the same time, the split option can be used to automatically divide the sequences into smaller groups (with the specified number of sequences in each) and apply the protocol to each group in turn (see also whole genome analysis). Note that this should only be used in cases where each sequence can be processed independently of all the others. This option was introduced in MotifLab v2.0.
-outputdir <directory>-dir Specifies the directory where the output files produced by MotifLab should be saved.
Note that this option was called -output (or -o for short) in versions prior to v2.0.
-output <data> <filename>-o This option was introduced in MotifLab version 2.0 and allows users to explicitly specify the names of files to which output data produced during protocol execution will be saved. Normally, all output data objects that are created with the "output" operation will be automatically saved to files after the protocol execution is completed. The filenames will be based on the names of the data objects (with suffixes reflecting the data format used). For example, an output data object named "BindingSites" which contains output in GFF-format will be saved to a file named "BindingSites.gff". However, the user can specify that this data object should be saved to a file named "out.txt" instead with the option "-output BindingSites out.txt". The -output option can be repeated multiple times on the same command line to provide filenames for multiple data objects.
-input <data> <value>-i This option was introduced in MotifLab version 2.0 and allows users to specify values for certain data objects on the command line, as explained in the section "data injection" below. The option can be repeated multiple times on the command line to supply values for multiple data objects.
-macro <name> <value>-m Allows values of protocol script macros to be defined on the command line (v2.0).
If the macro value contains spaces it must be enclosed in double quotes. The option can be repeated multiple times on the command line to supply definitions for several macros.
-log <filename>-l Specifies a log-file where MotifLab should output messages (rather than displaying these messages in the console)
-retry <setting>-r This option controls how MotifLab should behave upon encountering a serious error during protocol execution. The setting could either be "off", "prompt" or an integer number. When retry mode is set to "off", MotifLab will report any error to the user and thereafter directly end execution. If the mode is set to "prompt", MotifLab will report the error and then ask the user whether to end execution or to try once more (since the error could be caused by an intermittent problem, such as a network timeout, which might not occur the next time). If the setting is set to an integer number, MotifLab will report the error and then wait the specified number of seconds before automatically trying again (this will repeat itself until either the problem goes away and MotifLab can finish normally or until MotifLab is forcibly stopped by the user).
-inputSession <filename>-is Tells MotifLab to load a session from the given file before executing the protocol script. The session can contain data objects that are used by the protocol.
-saveSession <filename>-os Saves the entire session to the given file after the protocol is finished executing.
-no_output If this option is specified, output data will not be saved to files after the protocol is finished. This option is really only useful in combination with the -saveSession option or if the protocol itself contains commands to save the relevant data.
-config <setting> <value>-c Sets the value for the specified configuration setting. Depending on the setting, the value could be an integer number or a boolean value ("true"/"on" or "false"/"off"). This option can be repeated multiple times on the same command line to provide values for different settings, and once a setting has been specified it will be permanently stored by MotifLab.
Currently available settings include:
  • useFeatureDataCache (boolean)
  • useGeneIDMappingCache (boolean)
  • maxSequenceLength (integer)
  • maxConcurrentDownloads (integer)
  • concurrentThreadCount (integer)
  • networkTimeout (integer)
-plugin <plugin_name>
        <setting> <value>
Sets the value for the specified configuration setting in the plugin with the given name. Consult the documentation for the particular plugin to see which settings are available. This option can be repeated multiple times on the same command line to provide values for different settings
-verbose Turns on "verbose mode".
In verbose mode all status messages produced during execution will be output to the console.
-silent In silent mode, no messages will be output to the console during execution except for critical error messages.
-help-h Display a help message describing the available command line options

Data injection

The prompt operation can be used in protocol scripts to allow users to specify values for some types of data objects interactively while the protocol is being executed. This makes it possible to run the same protocol with different values for data objects without having to edit the actual protocol file itself. Whenever a prompt command is encountered during a protocol run, MotifLab will halt and ask the user to enter a value for a named data object. The execution of the protocol will not proceed until a satisfactory value has been provided. Although this behaviour is usually fine, it can be impractical if the user wants to run the protocol several times as a batch job.

With data injection the user can specify which values to use for data objects directly on the command line before starting MotifLab rather than having to wait for MotifLab to stop and ask. The command line option syntax is:
  -input <dataname> <value>  

The dataname should be the name of a data object that is used as the target for a prompt operation in the protocol script (this is required or else the data injection will not take place). If the data object is a Numeric Variable the provided value should be a number, if the data object is a Text Variable the value should be a text string (enclosed in double quotes if it contains spaces). For all other types of data objects, the value should be the name of a file which contains the input for the data object (in default format for the data type). If you want the value of a Text Variable to be read from file, you can use the prefix "file:" in the value.

Example:
-input cutoff 0.7 -input TF "CREB" -input Motifs C:/data/motifs.mlx -input Text1 file:C/data/doc.txt

Whole genome analysis

MotifLab was originally designed to perform analyses on a limited set of sequences, such as for instance a set of promoter sequences from co-regulated genes, and it provides efficient data access by keeping all the data in memory at all times. However, this also means that MotifLab might not be capable of handling extremely large datasets (e.g. whole genomes) that do not fit into the amount of memory available. Some researchers would nevertheless like to use MotifLab to process large datasets, for instance to perform genome-wide motif scanning for TF binding sites that could be filtered based on additional information such as conservation and epigenetic modifications. In such cases, it could be necessary to split a chromosome into smaller segments that are analyzed in turn, rather than loading data for the entire chromosome into memory at once. The "Whole genome analysis mode" that can was introduced in MotifLab version 2.0 allows this task to be performed automatically. The user can simply specify a (large) genomic region and MotifLab will split this region into smaller sequence segments and run the protocol in succession on (collections of) these segments until all of them have been processed. The genomic region to analyse is specified with the -sequences argument as usual, but rather than providing the name of a sequence file, the region is defined using the following format:
  -sequences "<genome build>,<region>,<segment size>,<collection size>,<overlap>"  

The first two fields (genome build and region) are required while the rest are optional. However, the order is important, so if you want to specify the overlap, the segment size and collection size must also be included.

The genome build should be a genome build identifier known to the system (e.g. "hg18" or "mm9").

The region specifies the chromosome, start coordinate and end coordinate of the region to be analysed in the format "chromosome:start-end". The start coordinate can be omitted and will then default to 1. For example, the sequence argument "hg19,chr20:10000000-20000000" will analyse the region from position 10000000 to 20000000 on human chromosome 20 (from the hg19 build) whereas the sequence argument "hg19,chr20:63025520" will analyse the whole of chromosome 20 (which is 63025520 bp long).

The segment size controls the size of the sequence segments that the genomic region should be divided into (defaults to 10Kbp).

The collection size decides how many of these sequence segments should be analysed at the same time (for each execution of the protocol script). This defaults to 100 segments.

The overlap length defaults to 0 bp but could be necessary to increase in order to avoid problems introduced by the sequence splitting.
For example, if a user wants to perform motif scanning on a long sequence region and this sequence is split in two at a location overlapping a potential binding site, this site can no longer be detected (since each of the sequence segments only receives half a site). By setting the overlap length to a value longer than any of the motifs studied, consecutive sequence segments will overlap by this amount and the full binding site will then be present in either one or both of the segments. To accomodate the overlap, the size of each sequence segment will normally be extended by the specified overlap length. This means that each segment starts at a coordinate on the form "start+k*(segment size)". For example, if the user wants to analyse the region "chr20:40000-44999" by splitting it up in segments of length 1000bp with 100bp overlap, the segments will cover the regions "40000-41100", "41000-42100", "42000-43100", "43000-44100" and "44000-44999" (so each segment starts at the same position that it would have started on if the overlap had been 0bp but ends further downstream). However, by declaring the overlap as a negative value, each segment will have the specified size, but the start position is adjusted instead. For example, splitting the same region as before with an overlap set to -100 will result in the sequence segments "40000-41000", "40900-41900","41800-42800","42700-43700","43600-44600" and "44500-44999".

Any output objects that are produced during whole genome analysis will be saved to files as usual, but each sequence group that is analysed in turn will result in a separate output file. The names of the output files will be based on the name of the data object as before, but the files will be distinguished by an additional sequence group number before the file-suffix. For example, if a genomic region is split into 387 segments and MotifLab is told to analyse up to 100 of these segments at a time (collection size=100), the files produced for an output object named "BindingSites" (in GFF format) would be "BindingSites_1.gff", "BindingSites_2.gff", "BindingSites_3.gff" and "BindingSites_4.gff" (where the first three files contain results for 100 segments each and the last file contains the results for the remaining 87 segments). The user can then optionally combine these files together using other command-line tools such as e.g. "cat" in UNIX. Note that if the overlap option is in use, the output files could contain overlapping information which would have to be filtered out to remove duplicates if all the files are concatenated.


Data Types

The figure below illustrates the various data types used by MotifLab. The three data types on the left — Sequence, Motif and Module — are sometimes collectively referred to as the basic types, because they represent the fundamental components that most other data types relate to.

The Motif data type models the binding sequence preferences of a transcription factor, and the cis-regulatory Module (CRM) type is a higher-order model of a set of transcription factors that bind cooperatively. The Sequence data type contains information about the origin of a sequence segment (such as a gene) and its location within the genome, but it does not contain the actual DNA sequence. This information is rather represented by a DNA Sequence Dataset, which is a subtype of the more general Feature Dataset type that contains information to annotate sequences. The two other Feature Dataset subtypes are Numeric Dataset, which holds a numeric value for each base within a sequence segment, and Region Datasets, which contains a list of regions representing sequence segments with specific properties, such as e.g. genes, repeat regions or transcription factor binding sites.

Objects of the three basic data types can be grouped into (homogeneous) Collections which is useful for referring to sets and subsets of objects, they can be clustered into Partitions or they can be associated with numeric or textual data using Maps.

MotifLab has a few more specialized data types used to represent DNA Background models, gene Expression Profiles and "Priors Generators", and some simpler data types to hold atomic Numeric and Text variables. Output Data objects hold text documents in various data formats produced by the output operation, and they can also contain additional embedded files, including images. Finally, results produced by different analyses are stored in Analysis objects, with each type of analysis having its own subtype.



Data objects, names and temporary data objects

Each data object in MotifLab must have a unique name which allows it to be unambiguously identified. Traditionally, the naming conventions for data objects follow the conventions for naming variables in most programming languages, i.e. the name must start with a letter and contain only letters, numbers and underscores. In MotifLab v2 the naming rules for sequences were relaxed a bit to allow sequences to retain names from gene identifiers. This included allowing sequence names starting with numbers (and containing only numbers), and also names containing hyphens, plus-signs, dots, parentheses and brackets.

Unlike variable names in most programming languages, however, the data objects in MotifLab can only be referenced through their primary identifier name (or indirectly as part of collections). Hence, data names in MotifLab do not really function like regular variable names, since it is not possible to have two different names referencing the same data object. E.g. if "MA0135" is the name of a motif data object, it is not possible to say "X = MA0135" and then use the name "X" to refer to the the motif "MA0135" later on.

If the names of data objects start with underscores, e.g. "_TextVariable1", they are considered as temporary data objects and are given special treatment by MotifLab. Temporary data objects will not be displayed in the GUI in any way, neither in the visualization panel (for sequences and feature datasets) or the data panels (for all data types). When temporary data objects are used in protocol scripts, they will be deleted immediately after the execution of the protocol ends. Temporary data objects can be used for intermediate processing steps whose results are not required to persists beyond the end of the protocol.

Sequence

A sequence in MotifLab represents a segment of a DNA strand spanning a specified number of bases. Usually, a sequence object will represent a "real sequence" where the location of the sequence segment and the genome build it originates from is known. For example, a sequence could span the segment from position 157,342,949 to position 157,343,321 on the reverse strand of chromosome 2 from the human genome build "hg19". Alternatively, a sequence object could represent an "artificial sequence" which is not tied to a specific location or genome build (or a "real sequence" whose actual location or genome build is simply not known). In either case, a sequence object in MotifLab is merely an "empty" template that contains very little information in itself. Specifically, even though it is referred to as a "sequence", it does not contain information about the actual DNA sequence found at the associated location. This information is contained in DNA Sequence Datasets, a type of Feature Datasets that can annotate sequence segments with additional information.

The required attributes of a Sequence object is:
  • Chromosome
  • Start coordinate
  • End coordinate
  • Strand orientation (default is "direct")
If the chromosome is not known (for instance for artificial sequences), it can be set to "?". In MotifLab, chromosomes always start at position 1, and both the start and end coordinates are inclusive (although certain data formats, like BED, might treat this differently).

A sequence can optionally be associated with a single gene and can then be annotated with the gene's name and the position of the transcription start site and end site.
  • Gene name
  • TSS
  • TES
In MotifLab v2, sequences can also be annotated with Gene Ontology terms and other user-defined properties.

Creating Sequences

Sequences are normally created in MotifLab via the "Add Sequences" dialog which can be opened by selecting "Add Sequences" from the "Data" menu or by pressing the double-helix button in the tool bar. In protocol scripts, it is possible to create single (artificial) sequences with specified lengths or (real) sequences defined in BED or Location formats. Multiple sequences can be created with a single command by importing sequence definitions from a Location-, BED- or FASTA-file into the default sequence collection called "AllSequences". The Location-format supports all kinds of sequence metadata (including genome build and location of TSS/TES), but BED-files only contain information about the chromosomal location for each sequence and not its genome build. It is possible to update the genome build for each sequence afterwards, however, with the set[property] command. When importing sequences from FASTA files, the sequence metadata will be included if this information is present in the header of each sequence. If no metadata is present, MotifLab will just create artificial sequences based on the lengths of the sequences found in the FASTA file.
Note that even though the FASTA file contains the actual DNA sequences, only the metadata/length of the sequences will be used to create sequence objects. To include the actual DNA sequence you must also create an additional DNA Sequence Dataset based on the same FASTA file.
One final way to create new sequences is to extract subsegments from existing sequences with the split_sequences operation.

# Create an "artificial sequence" with length 2000bp and location "chr?:1-2000" from an unknown genome
Seq1 = new Sequence(2000)


# Create a new sequence specified in (comma-separated) BED-format with location "chr2:1001-2000"
# BED-format arguments: chr,start,end [,gene name,score,strand]
Seq2 = new Sequence(chr2,1000,2000)

# Create a new sequence specified in (comma-separated) BED-format with location "chr2:1001-2000",
# gene name "BRAC1" and reverse orientation. The score attribute in the fifth BED-column is ignored
Seq3 = new Sequence(chr2,1000,2000,BRAC1,100,-)


# Create a new sequence with location "chr22:36783864-36786063" (reverse strand) from human genome hg19
# associated with the gene "MYH9" with TSS at position 36784063 and TES at position 36677327
# Location-format arguments: Gene name, genome build, chromosome, start, end, TSS, TES, orientation
ENSG00000100345 = new Sequence(MYH9, hg19, 22, 36783864, 36786063, 36784063, 36677327, REVERSE)

# Same as previous example but the TSS and TES annotations are left out
ENSG00000100345 = new Sequence(MYH9, hg19, 22, 36783864, 36786063, - , - , REVERSE)


# Create a new sequence spanning 2000bp upstream to 200bp downstream around the transcription start
# site of gene "NTNG1" in genome hg18 (gene identifier provided in "HGNC Symbol" format)
# Location-format arguments: Gene identifier, identifier type, build, relative start, relative end, anchor
Seq4 = new Sequence(NTNG1, HGNC Symbol, hg18, -2000, 200, TSS)

# Create a new sequence spanning 100bp upstream to 100bp downstream around the transcription end site
# of Entrez gene "56475" from genome build hg18
Seq5 = new Sequence(56475, Entrez gene, hg18, -100, 100, TES)

# Create a new sequence spanning the full length of Ensembl gene ENSG00000111249 from hg19
Seq6 = new Sequence(ENSG00000111249, Ensembl Gene, hg19, 0, 0, full gene)

# Same as previous example but extended with 500bp additional flanking sequence on both sides
Seq7 = new Sequence(ENSG00000111249, Ensembl Gene, hg19, -500, 500, full gene)


# Load multiple sequences from file in Location format
AllSequences = new Sequence Collection(File:"C:\data\MuscleGenes_-2000+200.txt", format=Location)

# Load sequences from file in BED format. The genome build for all the sequences is set afterwards
AllSequences = new Sequence Collection(File:"C:\data\genes.bed", format=BED)
set AllSequences[genome build] to "mm9"


# Create new sequences based on the EnsemblGenes annotations (region track) of the current sequences,
# then delete the original sequences. The relationship between new and old sequences is recorded
# in the returned SequencePartition
SequencePartition1 = split_sequences based on EnsemblGenes. Delete original sequences

Modifying Sequences

Because so many other data objects depend on sequences and the locations represented by these objects, sequence objects are usually not allowed to be changed or even renamed after they have been created. Especially, new sequences cannot be created nor can existing sequences be extended after feature datasets have been added (since there would be no feature data for the new sequence segments). However, sequences can still be cropped and dropped.

In MotifLab v2, a few sequence properties – namely "genome build", "TSS", "TES", "orientation" and "gene name" – are allowed to be changed after creation. In addition, sequences can be annotated with gene ontology terms and other user-defined properties. The properties of a single sequence can be modified by right-clicking on the name label for a sequence in the Visualization panel (to the left of the tracks visualization) and then selecting "Display sequencename" from the context-menu to bring up a dialog window. Properties for single sequences or collections of sequences can also be updated with the set operation.

# Set the genome build of sequence "Seq1" to "mm9" (this will also update the organism)
set Seq1[genome build] to "mm9"

# Set the associated TSS position of sequence "Seq1" to 391829
set Seq1[TSS] to 391829

# Set the "gene name" property of every sequence based on corresponding strings in the Sequence Map NameMap1
set AllSequences[gene name] to NameMap1

# Set the TSS property of every sequence based on corresponding values in the Sequence Numeric Map TSSpos
set AllSequences[TSS] to TSSpos

# Set the strand orientation of all the sequences in the "Upregulated" collection to the reverse strand
set Upregulated[orientation] to "reverse"

Using Sequences

Individual sequence objects are rarely used directly in MotifLab, but are rather used as templates for other feature datasets or are referenced to (by name only) as part of collections, partitions and maps. Only a few types of analyses currently make use of information stored directly in sequence objects, such as gene ontology term enrichment analyses.



Feature Dataset

Sequence objects are used in MotifLab to refer to specific sequence segments of a genome, but this data type does not contain any additional information about what is going on at these locations (apart from some metadata). Further location-specific annotations are kept in feature datasets which come in three different types:
  • DNA Sequence Datasets hold the actual DNA sequence from the corresponding sequence segment (one base letter for each position)
  • Numeric Datasets hold information that can be represented numerically along the sequence (one value for each base position)
  • Region Datasets hold information about discrete sub-segments with specific properties within the sequence segment
In MotifLab's graphical user interface, all Feature Datasets are listed in the "Features" data panel which is usually located at the top of the left panel, and the feature data tracks themselves are shown for each sequence in the Visualization Panel. You can configure the visual appearance of feature tracks by right-clicking on a dataset in the "Features" panel (or selecting multiple by holding down the SHIFT or CONTROL keys) and then select options from the context menu or with keyboard short-cuts.



DNA Sequence Dataset

DNA Sequence Datasets (also called DNA tracks or DNA sequence tracks) are used to hold the DNA sequence for a sequence segment, represented with one base letter for each position within the sequence. Most often, objects of this type will hold the original DNA sequence from that location, but this does not have to be the case. The DNA sequence could instead be a slightly modified version of the original sequence, a scrambled version or even a fully artificially created sequence. The base letters would normally be either A, C, G or T, but all types of letters are allowed in the sequence. For instance could N's or X's be used to mask portions of a sequence. Base letters can be in either uppercase or lowercase, and the case may or may not be important depending on the context and the tools used to analyze the sequence. For example, lowercase letters can be used to indicate repetitive segments of a sequence that should be ignored by a motif discovery tool.

DNA sequences are always stored relative to the direct strand internally in MotifLab (independent of the annotated strand orientation of the sequence), but DNA sequences can be converted on-the-fly to display or manipulate the sequence relative to either strand when necessary.

Creating DNA Sequence Datasets

DNA Sequence Datasets are normally imported from predefined tracks or loaded from files (in FASTA or 2bit format), but they can also be artificially created based on a background distribution.

# Import the DNA sequence for the current sequences from the preconfigured track called "Genomic DNA"
DNA = new DNA Sequence Dataset(DataTrack:Genomic DNA)

# Import the DNA sequences for the current sequences from a FASTA file. Note that the sequence objects
# must already have been created and match the names and lengths of the sequences in the FASTA file.
DNA = new DNA Sequence Dataset(File:"C:\data.fas", Format=FASTA)

# Create a new 'empty' DNA sequence track consisting of only N's
DNA = new DNA Sequence Dataset()

# Create a new DNA sequence track consisting of only A's (on the direct strand)
DNA = new DNA Sequence Dataset('A')

# Create an artificial DNA sequence track by randomly sampling base letters from the distribution
# defined in the background model object "EDP_human_3"
DNA = new DNA Sequence Dataset(EDP_human_3)

Modifying DNA Sequence Datasets

The main operation for modifying DNA Sequence Datasets is mask, which can replace base letters in certain positions with new letters or change the case of the letters. In addition, the plant operation can insert new binding motifs for transcription factors into an existing DNA sequence.
The GUI's draw tool allows users to manipulate the DNA sequence by drawing or typing directly into the visualized track.

# Replace the DNA sequence letters with the letter X within RepeatMasker regions
mask DNA with "X" where inside RepeatMasker

# Replace the DNA sequence letters with the letter "A" within RepeatMasker regions
# taking the strand orientation of the sequences into account
mask DNA on relative strand with "A" where inside RepeatMasker

# Change the case of all DNA bases outside of gene regions to lowercase.
# Return the result as a new track named "DNA_masked"
DNA_masked = mask DNA with lowercase where not inside EnsemblGenes

# Replace bases within TFBS regions with new bases randomly sampled from the background model "EDP_human_3"
# (This will destroy the binding motifs)
mask DNA on relative strand with EDP_human_3 where inside TFBS

# Replace bases within TFBS regions with the "sequence" property annotated in these regions
mask DNA with TFBS

# Insert the motif M00003 at a random location in each sequence (overwriting the current sequence)
# Return the modified sequence in a new track called "SequenceWithMotif".
# The region track "PlantedMotifs" indicate where the motif was planted in each sequence.
[SequenceWithMotif,PlantedMotifs] = plant M00003 in DNA

Using DNA Sequence Datasets

DNA sequence tracks are used as input to motif discovery and motif scanning tools (and also module discovery/scanning) and similar operations or tools that search DNA sequences for specific patterns (such as the search and score operations). Background Models can be derived from DNA tracks, and base frequency statistics can also be derived with the statistic operation or the GC-content analysis. Sequence dependent characteristics of the DNA helix, such as e.g. stacking energy and propeller twist, can be derived from a DNA track with the physical operation and represented with numeric tracks. In MotifLab v2 it is possible to extract the corresponding amino acid sequence from the DNA sequence for all six reading frames.

DNA sequence tracks can also be referenced in conditions, as demonstrated in the last example below. Here, segments of a DNA sequence masked with X's are used to derive a new Region Dataset representing these masked portions. This is done by first creating a Numeric Dataset with value 1 for every position with an X and then converting this numeric track to a region track.

# Search for the pattern "CACGTG" within the DNA sequence and return matching regions in a new track
Matches = search DNA for "CACGTG" on both strands

# Use the MATCH algorithm to scan for matches to JASPAR motifs in the DNA sequence
TFBS = motifScanning in DNA with MATCH {Motif collection=JASPAR,Matrix threshold=0.9}

# Use the DNA track (on the relative strand) to derive a second-order Markov model of the base distribution
BGmodel = new BackGround Model {Track:DNA, Order=2, Strand=Relative}

# Count the number of T's in each sequence. Return the result as a Sequence Numeric Map
T_count = statistic "T-count" in DNA on relative strand

# Derive the GC-frequency from annotated CpG island regions of each sequence
GC_content = statistic "GC-content" in DNA where inside CpG_islands

# Perform GC-content analysis. Results are returned as an Analysis object rather than a numeric map
GC_content = analyze GC-content {DNA track = DNA}

# Derive a measure of 'propeller twist' along the DNA helix
twist = physical property "propeller twist" derived from DNA using window of size 10 with anchor at center

# Derive the amino acid sequence corresponding to the DNA sequence on the direct strand
# using a reading frame offset 2bp from the start of the sequence. The AA sequence is returned
# as a region track with consecutive 3bp regions named after the amino acids
AA_frame2 = extract "Direct-2" from DNA as Region Dataset

# Derive a Region Dataset representing the masked regions of a DNA sequence.
MaskedRegions = new Numeric Dataset(0)
set MaskedRegions to 1 where DNA equals "X"
convert MaskedRegions to region where MaskedRegion > 0



Numeric Dataset

Numeric Datasets (also called numeric tracks) represent information with one numeric value for each position within a sequence segment. The type of information stored in numeric datasets could be, for instance, (per base) phylogenetic conservation levels, physical or statistical characteristics of the DNA sequence/double helix (e.g. helix twist and roll, or local GC-content), the distance from each sequence position to some target feature, per base quality scores (for sequence reads), number of ChIP-seq tag counts per position, and position-specific priors used to guide motif discovery, to list but a few examples.

Creating Numeric Datasets

Numeric annotation tracks (based on e.g. data from UCSC Genome Browser or other databases) can be imported from preconfigured tracks or loaded from files in various formats. Numeric tracks can also be derived from information in other types of tracks. For example, Priors Generators can be trained with machine learning methods to predict the location of certain features based on combined information from several different tracks. The output from a Priors Generator is a numeric track where each position reflects a prior probability (or likelihood) that the position could overlap with the target feature (for example a TF binding site).

# Import the "PhastCons100way" annotation track for the current sequences
Conservation = new Numeric Dataset(DataTrack:PhastCons100way)

# Import a conservation track from file in WIG format.
Conservation = new Numeric Dataset(File:"C:\phastcons.wig", Format=WIG)

# Create a new 'empty' numeric track where each position has a value of zero
Empty = new Numeric Dataset

# Create a new numeric track where each position is assigned the initial value 42
Answer = new Numeric Dataset(42)

# Create a new numeric track where the value at each position is the average of the values
# from three other tracks
AverageValueTrack = combine_numeric track1,track2,track3 using average

# Convert the existing region track "CpG_islands" into a numeric track such that all positions
# within the original regions are assigned the value 100 and all other position are assigned a value of 0
convert CpG_islands to numeric with value = 100

# Create a new track by counting the number of TFBS regions that overlap with a 5bp window
# centered around every position in the track
CountTrack = count number of regions in TFBS overlapping window of size 5 with anchor at center

# Create a new track where the value in each position is the distance (in bp)
# to the closest annotated EnsemblGenes region
DistanceToClosestGene = distance from EnsemblGenes

# Create a new track based on a measure of predicted 'propeller twist' along the DNA helix
twist = physical property "propeller twist" derived from DNA using window of size 10 with anchor at center

# Use the TFBSoracle priors generator to derive a new positional priors track based on
# an (implicit) set of feature tracks known to the priors generator object
TFBS_prior = predict with TFBSoracle

Modifying Numeric Datasets

Existing numeric datasets can be modified with arithmetic operations (increase, decrease, multiply and divide) or assigned explicit values with the set operation. They can also be transformed with various mathematical functions (including square root, logarithm and random number), the values could be normalized to a new range or thresholded to create "binary valued" tracks. All of these operations work on a position-by-position basis, but the apply operation will transform tracks with sliding window functions which allow the new value in each position to be derived from values of several positions in a neighbourhood around each sequence position.
In addition, the GUI's draw tool allows users to manipulate numeric datasets by drawing directly into the visualized track.

# Increase the values in the Conservation track by 2 for every position
increase Conservation by 2

# Increase the values in the Conservation track by the values from another track (position by position)
increase Conservation by DistanceToClosestGeneTrack

# Assign the Conservation track a value of 0 within all repeat regions
# Return the results in a new track
MaskedConservation = set Conservation to 0 where inside RepeatMasker

# Return a new track based on the absolute values of Track1 (negative values converted to positive)
Track2 = transform Conservation with absolute

# Rescale Track1 so that the values fall within the new range 10 to 100.
# (i.e. the smallest value in the track will now be 10 and the largest value will now be 100)
normalize Track1 from range [dataset.min,dataset.max] to range [10,100]

# Transform the Conservation track so that all values previously above (or equal to) 0.5 will be set to 1
# and those below will be set to 0
threshold Conservation with cutoff=0.5 set values above cutoff to 1 and values below cutoff to 0

# Smooth the Conservation track by applying a 25bp wide "Bartlett" sliding window.
# This will assign each position a new value based on a weighted average of the values in its vicinity
SmoothConservation = apply Bartlett window of size 25 with anchor at center to Conservation

Using Numeric Datasets

MotifLab is an expansion of an earlier program called PriorsEditor whose primary purpose was for creating numeric tracks that could be used as position-specific priors to guide the motif discovery process. In addition, apart from being merely descriptive and informative, numeric tracks can be used in conditions to limit operations to certain positions in the sequence or to regions with certain value distributions within their sites.

# Search for motifs and binding sites with MEME using the "Conservation" track as positional priors
[TFBS,MEMEmotifs] = motifDiscovery in DNA with MEME {Positional priors=Conservation, ... }

# Mask positions in the DNA sequence with low conservation
mask DNA with "N" where Conservation < 0.2

# Remove predicted TFBS regions with low conservation within the site
filter TFBS_predicted where region's average Conservation < 0.2

# Use the statistic operation to find the maximum tag count value across all positions in a track.
# The result is returned as a Sequence Numeric Map with maximum values for each individual sequence
# and with a default map value reflecting the highest count across all sequences
Max_tag_count = statistic "maximum value" in ChIPseq_tag_counts

# Discover whether TF binding sites are more conserved than other parts of the genome
# by analyzing the distribution of conservation track values inside versus outside TFBS regions
Analysis1 = analyze numeric dataset distribution {Numeric dataset = Conservation, Region dataset = TFBS}



Region Dataset

Region Datasets (also called region tracks) contain sets of regions which are discrete segments of the sequence with associated properties. Such regions could represent e.g. genes, exons, coding regions, DNase hypersensitive sites, ChIP-seq peak regions, CpG-islands, repeat regions, SNPs and transcription factor binding sites. Each region has a location within its parent sequence defined by a start and end position, and by extension also a length (which technically could be 0 but not negative) and genomic location (if the genomic location of the parent sequence is known). Other standard properties of regions include a type, a numeric score value and a strand orientation (which can be either "direct", "reverse" or "undetermined" and is relative to the genome not the parent sequence). Additional user-defined properties can be specified for regions as well, like for example the start and end coordinates for CDS subregions of genes or a "sequence" property for TFBS regions denoting the actual binding sequence at the particular site. These user-defined properties can either have boolean, numeric or textual values.

Regions in the same track may overlap with each other, and regions are also allowed to extend beyond the boundaries of their parent sequence (and could in theory also be located fully outside the sequence). The consequences of regions extending outside of a sequence may differ depending on the particular operation or analysis applied to region tracks.

Motif track
A motif track is a special kind of region dataset where the type properties of the regions refer to known motifs. Some operations, like motifDiscovery and motifScanning will always return motif tracks, and the motif track status is normally preserved when tracks are manipulated with other operations as well. When region datasets are imported from files or preconfigured tracks, the regions are checked to see if they could potentially correspond to motif sites by comparing the regions' names and lengths to currently defined motifs. If enough regions match with known motifs, the dataset will automatically be converted to a motif track. Region datasets can also be converted to motif tracks manually by right-clicking on a region dataset in the Features Panel and selecting "Convert to Motif Track" from the context menu, or with the following display setting command: $motifTrack(<trackname>)=true.
Motif tracks are listed with names in boldface in the Feature Panel in MotifLab's graphical user interface.

Module track
A module track is a special kind of region dataset where the type properties of the regions refer to known modules. Some operations, like moduleDiscovery and moduleScanning will always return module tracks, and the module track status is normally preserved when tracks are manipulated with other operations as well. When region datasets are imported from files or preconfigured tracks, the regions are checked to see if they could potentially correspond to module sites by comparing them to currently defined modules. If enough regions match with known modules, the dataset will automatically be converted to a module track. Region datasets can also be converted to module tracks manually by right-clicking on a region dataset in the Features Panel and selecting "Convert to Module Track" from the context menu, or with the following display setting command: $moduleTrack(<trackname>)=true.
Module tracks are listed with names in bold italics in the Feature Panel in MotifLab's graphical user interface.

Nested track
A nested track is a special kind of region dataset where the regions may contain nested child regions. For example, in a gene annotation track the top-level gene regions could contain nested regions corresponding to exons within each gene. The module track type described above is actually a kind of nested track where the nested regions correspond to individual motif sites within the module. The extract operation can be used to create new (un-nested) tracks based on only the top-level regions or the child regions of a nested track.
Nested tracks are listed with names in italics in the Feature Panel in MotifLab's graphical user interface.

Creating Region Datasets

Region annotation tracks (based on e.g. data from UCSC Genome Browser or other databases) can be imported from preconfigured tracks or loaded from files in various formats. Operations that search for particular patterns within DNA sequences (including motifDiscovery, motifScanning, moduleDiscovery, moduleScanning and search) will usually return the resulting matches as a region track, and regions can also be derived from numeric tracks with the convert operation. The extract operation can extract child regions from a nested track and also extract the start, end and center positions of regions.

# Import the preconfigured "RepeatMasker" annotation track for the current sequences
Repeats = new Region Dataset(DataTrack:RepeatMasker)

# Import a region track from file in BED format.
Genes = new Region Dataset(File:"C:\RefSeqGenes.bed", Format=BED)

# Create a new 'empty' track with no regions
Empty = new Region Dataset

# Create a new region track based on all the regions from three other tracks
AllRegions = combine_regions track1,track2,track3

# The search operation returns a new region dataset with regions matching the search pattern
Matches = search DNA for "CAssTG" on both strands

# The motifDiscovery operation will return both a Region Dataset (motif track)
# with the discovered binding sites and a collection with the newly discovered motifs
[TFBS,Motifs] = motifDiscovery in DNA with MEME { ... }

# Create a new region track with regions based on consecutive segments in the sequence
# with values above 0.8 in the Conservation track
ConservedRegions = convert Conservation to region where Conservation > 0.8

# Extract individual TFBS "child regions" from a module track
BindingSites = extract "TFBS" from ModuleTrack as Region Dataset

# Create a new track with 1bp long regions corresponding to gene transcription start sites
# by extracting the first position from each gene region (relative to its own orientation)
TSS = extract "regionStart" from EnsemblGenes as Region Dataset

Modifying Region Datasets

Operations targeting region tracks will either modify the properties of existing regions, remove regions from the track (filter and prune) or merge regions together. The start and end positions of regions cannot normally be manipulated directly (with e.g. set or arithmetic operations), but some operations like extend can change the size of regions and thereby also alter their location.

Most numerical operations that can be used to modify numeric tracks, numeric maps and numeric variables can also be applied to modify numeric properties of regions. Text properties can be altered with the set and replace operations. If the arithmetic operations (increase, decrease, multiply and divide) are applied to text properties of regions, they will function like set operations treating the properties as (comma-separated) lists of values. The increase and multiply operations will then function like set addition (union) whereas the decrease and divide operations will function like set subtraction. However, if arithmetic operations are applied to boolean region properties they function like the following boolean operators: increase = OR, multiply = AND, decrease = NOR, divide = NAND.

There are currently no operations that can add new regions to an existing region track, but the GUI's draw tool allows users to draw new regions directly into the visualized track, to delete existing regions and to modify a region's properties in a popup dialog.

# Remove all predicted TFBS regions that are within gene regions
filter TFBS where region inside EnsemblGenes

# Remove overlapping TFBS regions representing the same binding motif (as defined in the partition)
# and keep only the top scoring region from each cluster
prune TFBS remove "alternatives" from MotifPartition1 keep "top scoring"

# Reduce the score of TFBS regions by half if they overlap with repeat regions
divide TFBS by 2 where region overlaps RepeatMasker

# Set the "conservation" property of every TFBS region to the average value from the Conservation track within each site
set TFBS[conservation] to average Conservation

# Increase the numeric region property "count" by a value defined in the variable for all regions
increase TFBS[count] by NumericVariable1

# This command goes through every RepeatMasker region and looks up its type property in the NameMap map
# Then it replaces the type of the region with the corresponding value from the map
replace NameMap in RepeatMasker property "type"

# Increase the size of all DNaseHS regions by 20 bp in both directions
extend DNaseHS by 20

# Extend all promoter regions in the upstream direction until they hit the closest gene
extend Promoter upstream until inside EnsemblGenes

# Merge overlapping ChIPseq regions of the same type into single regions
merge similar ChIPseq

# Merge all DNaseHS regions located closer than 10 bp apart from each other
# (Replace the original regions with a new region beginning at the start of the first region
# and ending at the end of the last region)
merge DNaseHS closer than 10

Using Region Datasets

The primary purpose of MotifLab is to predict transcription factor binding sites and cis-regulatory modules within DNA sequences, and region datasets are used to represent such sites. In addition, apart from being merely descriptive and informative, region tracks can be used in conditions to limit operations to certain portions of the sequence. Several different analyses can be applied to region datasets to examine the coverage of the regions in a single dataset, to compare the overlap between two datasets, or to count the number of occurrences of each type of region in a dataset and compare this to another frequency distribution.

# Search for potential transcription factor binding sites in the DNA sequence
# and output the predicted sites in BED format
TFBS = motifScanning in DNA with MATCH { ... }
output TFBS in BED format

# Use the RepeatMasker dataset in a condition to mask only
# segments of the DNA sequence that fall within repeat regions
mask DNA with "N" where inside RepeatMasker

# Count the number of TFBS regions for each motif type and compare these counts to a background
# frequency distribution to determine which motifs are overrepresented in this dataset
Analysis1 = analyze count motif occurrences {Motif track=TFBS, Motifs=JASPAR,
                                             Background frequencies=ExpectedFreq,
                                             Significance threshold=0.05,
                                             Bonferroni correction="All motifs"}

# Count the number of TFBS regions for each motif type within two sequence subsets
# representing respectively upregulated and downregulated genes.
# Compare these counts between the two sets and use a binomial test to determine
# which motifs are over- or underrepresented in one of the sets compared to the other
Analysis2 = analyze compare motif occurrences {Motif track=TFBS, Motifs=JASPAR,
                                               Target set=UpregulatedGenes,
                                               Control set=DownregulatedGenes,
                                               Statistical test="Binomial",
                                               Significance threshold=0.05,
                                               Bonferroni correction="All motifs"}



Motif

The Motif data type models the DNA binding recognition sequence of a particular transcription factor (or group of related factors).
Motif scanning tools can be used to predict potential binding sites for different transcription factors by searching DNA sequences for good matches to their corresponding motif models. MotifLab comes bundled with collections of experimentally determined binding motifs from several databases, including TRANSFAC and JASPAR. Novel motifs can also be predicted from sets of sequences with de novo motif discovery tools, or users can define new motifs directly by manually specifying a binding matrix, consensus sequence or explicit list of binding sequences.

Motif properties

The motif type is one of the richest data types in MotifLab in terms of the amount of different information it can contain.
A list of standard motif properties are described below. Except for "ID" and "matrix", all of these are optional.
In addition to these, motifs can also have extra user-defined properties.
PropertyDescription
IDThe ID or identifier of a motif is the same as the name of the motif data object. This is set when the data object is created and can not be changed later. The ID is usually in the form of a database specific identifier (e.g. M00037 or MA0004).
Short nameA concise name for the motif; usually an abbreviation of the name of the transcription factor such as "AP-1" or "CREB".
Motifs from the TRANSFAC collection have short names on the form "X$yyy_nn" where X is a single letter code denoting a species group (V=vertebrates, I=insects, P=plants, N=nematodes, B=bacteria, F=fungi), yyy is a TF abbreviation and nn is either a quality code, consensus flag or incremental number (for discriminating between different motif models for the same factor).
Clean short name†This is derived from the short name by stripping away the "X$" prefix and "_nn" suffix for TRANSFAC motifs so that only the TF abbreviation remains.
Long nameA longer name for the motif; usually the full name of the transcription factor such as "Activator Protein 1" or "cAMP-responsive element binding protein"
Names†This is a list consisting of both the short name and the long name together with the names of all annotated binding factors
Presentation name†This is a concatenation of the ID and the short name, e.g. "M00001-V$MyoD_01".
This form is often used to refer to motifs in the GUI since the ID is usually not very informative by itself.
Size†The size of the binding model (i.e. the length of the consensus sequence or number of rows in the binding matrix).
MatrixA representation of the DNA binding sequence of the transcription factor in the form of a matrix model.
ConsensusA concise representation of the binding model in the form of an IUPAC consensus sequence, e.g. "sGGrnTTTCC".
This property is usually derived from the binding matrix, but it is also possible to assign a new consensus sequence to the motif (in which case the the binding matrix will also be updated to correspond with the new consensus).
Matrix type†This can be either count, frequency or weight depending on the format of the binding matrix
Support†If the matrix is a count matrix this property returns the number of binding sequences that the model was based on (equal to the sum of one row in the matrix).
GC-content†The fractional sum of G's and C's in the binding matrix. Reflects the factor's preference for binding to GC-rich sequences.
IC-content†The information content of a matrix is a measure of its binding specificity which is again inversely related to the number of sequences the that motif will match. IC-content is usually correlated with motif size (longer motifs match fewer sequences) but more importantly with the amount of variation allowed by the binding motif (more degenerate motifs have lower IC and therefore match more sequences).
The IC of a single position i within a motif is calculated with the formula:  2+∑b∈A,C,G,T  fb,i log2( fb,i ), where fb,i is the frequency of base b in position i, and the total IC of a motif is the sum over all positions. A position which only allows a specific base has the maximum IC of 2.0 and a position which does not show any preference towards a particular base has the minimum IC of 0. For a motif of length N the IC can thus range from 0 to 2*N (most specific).
FactorsNames of transcription factors associated with this motif. This could be a single factor or several related factors. It is also possible to include different aliases and synonyms for the same factor.
ClassificationA class tag consisting of up to four numbers separated by dots, e.g. "3.5.1.2", where the first number identifies the superclass, the second number the class, the third number the family and the fourth number the subfamily of the transcription factor according to the classification hierarchy introduced by the TRANSFAC database.
Class name†The corresponding name of the class tag. E.g. the class "3.5.1.2" has the name "Myb-like factors".
DescriptionA general description of the motif and its associated transcription factor(s) in free-text.
GOA set of gene ontology terms that describe the transcription factor
OrganismsA list of species on which the motif model is based (or a list of species for which the motif model could potentially be relevant).
ExpressionA list of tissue or cell-types where this transcription factor is known to be active
AlternativesA list of other known motifs that cover the same transcription factor and are thus equivalent to this motif (but not necessarily 100% identical). The TRANSFAC and JASPAR motif collections that come bundled with MotifLab are annotated with known alternatives both within and between the collections.
InteractionsA list of other motifs that are known to interact with this motif (or rather, their TFs are known to interact). This information can be used to automatically create Module Collections from known interactions. It is also used by the "Interactions Viewer" tool to highlight binding sites for interacting factors in the vicinity of a selected target binding site. Of the motif collections that come bundled with MotifLab, only TRANSFAC is annotated with this kind of information.
QualityA numeric quality measure ranging from 1 (best) to 6 that reflects the experimental reliability of the protein-DNA or miRNA-RNA interactions whose binding sites form the basis for this motif model.
  1. Functionally confirmed transcription factor or miRNA binding site
  2. Binding of pure protein or miRNA (purified or recombinant)
  3. Immunologically characterized binding activity of a cellular extract
  4. Binding activity characterized via a known binding sequence
  5. Binding of uncharacterized extract protein to a bona fide element
  6. No quality assigned
PartDescribes the portion of the binding recognition sequence required for protein binding and activation that is actually covered by this motif model.
  • Full: This motif covers the full recognition sequence
  • Halfsite: This motif only covers a small part of the full sequence required for binding and activation,
    for example half of a dimeric binding sequence.
  • Dimer or Oligomer: This motif represents a concatenation of two or more binding sequences.
Note that this information is not always reliable in the motif collections that come bundled with MotifLab.

† These properties are derived from other properties and can not be altered directly.

Matrix model

The main way the binding motif is modelled in MotifLab is with a position-specific scoring matrix (PSSM), sometimes also called a position count matrix (PCM), position frequency matrix (PFM) or position weight matrix (PWM) depending on its format. This matrix is in the form of an N×4 table where each column represents one of the four DNA bases and each of the rows represent one position in the binding motif.

A simple count matrix can be created from a set of binding site sequences (aligned and of equal length) by going through each sequence position in turn, counting the number of times each base letter occurs in that position across all the sites and entering this number into the matrix at the corresponding row and column. For example, a matrix derived from the four 6bp binding sequences "CACGTG,CAGGTG,CACGTG,CACGTT" would look like this:

ACGT
0400
4000
0310
0040
0004
0031

If a matrix is based on a large number of binding sites, the magnitude of the value for a particular base in row i relative to the other bases should approximate well the transcription factor's relative preference towards that base in that position of the binding recognition sequence.

A count matrix can be converted into a frequency matrix by dividing the value of each cell with the total sum of the row so that the combined frequencies of the four bases sum to 1.0 for each position. Such a frequency matrix can be further transformed into a weight matrix by replacing each cell value with the log-ratio log( fi,b / pb ), where fi,b is the frequency of base b in position i and pb is the background probability of observing that base in entire genome. A value of 0 for a base b at position i in a weight matrix thus means that the transcription factor shows no particular preference for that base in that position of the recognition sequence (taking the background distribution into account). A positive value reflects a higher preference for that base relative to the other bases and a negative value reflects a lower preference for that base.

When MotifLab imports motifs from a file, the matrix models will be kept in their original formats, but MotifLab also tries to detect what kind of format this is so that the matrix can be dynamically converted into other formats if necessary.
The rules for determining the format based on the matrix values are:
  • If the matrix only contains positive integer numbers it is considered to be a count matrix
  • If the matrix contains negative numbers it is considered to be a log-transformed weight matrix
  • If all the values are between 0 and 1.0 and each row sums to 1.0 it is considered to be a frequency matrix
  • If none of the above rules apply the matrix is considered to be an unnormalized frequency matrix
When converting a weight matrix into a frequency matrix, MotifLab will always assume a uniform background distribution ( pb=0.25 for all bases).

Consensus model

A secondary way to represent the binding model of a motif is with a consensus string. This is a string of base symbols, one for each position in the binding motif, denoting either single DNA bases or degenerate bases that represent groups of two or more DNA bases with a single symbol.
The notation follows the standard suggested by IUPAC:
SymbolRepresentsNameComplement
AAAdenineT
CCCytosineG
GGGuanineC
TTThymineA
RA or GPurineY
YC or TPyrimidineR
MA or CAminoK
KG or TKetoneM
WA or TWeakW
SG or CStrongS
BC, G or TNot AV
DA, G or T Not CH
HA, C or TNot GD
VA, C or GNot TB
Nany baseAnyN

If a motif already has a matrix model, the correponding consensus string will be derived from that matrix in accordance with the rules outlined in the section below. If the motif has a consensus string but not a matrix model, a matrix will be constructed based on the consensus string.

Deriving an IUPAC consensus string from a matrix
To determine the IUPAC symbol to use for a given position in the binding motif, the following rules are tried in order:
  1. A single base letter (A,C,G,T) is used if the frequency of that base is at least 50% and also at least twice the frequency of any other base
  2. A double-degenerate letter (m,r,w,s,y,k) is used if the combined frequencies of two bases are at least 75%.
  3. A triple-degenerate letter (b,d,h,v) is used if one of the bases has a frequency of zero.
  4. If none of the previous rules apply, the wildcard letter 'n' will be used.

Deriving a matrix from an IUPAC consensus string
A consensus string is converted into a frequency matrix by looking up the base symbol at each position i in the table below and assigning the corresponding values to row i in the matrix.
SymbolACGT
A1.00.00.00.0
C0.01.00.00.0
G0.00.01.00.0
T0.00.00.01.0
R0.50.00.50.0
Y0.00.50.00.5
M0.50.50.00.0
K0.00.00.50.5
W0.50.00.00.5
S0.00.50.50.0
B0.00.3330.3330.333
D0.3330.00.3330.333
H0.3330.3330.00.333
V0.3330.3330.3330.0
N0.250.250.250.25


Creating motifs

Motifs are usually generated by motif discovery methods or loaded from pre-defined collections. However, it is also possible to define new motifs manually. In the GUI, select "Add New ⇒ Motif" from the "Data" menu or press the plus-button in the Motifs Panel and select "Motif" from the drop-down menu. This will bring up the Motif dialog. The dialog contains multiple tabs where you can enter values for various motif properties. The only required property is the binding motif itself, which can be specified either as a matrix model or a consensus sequence. Consensus sequences can be entered in IUPAC notation (see above) or as a list of individual binding sequences (separated by any non-letter character). The matrix model will then be created automatically from the consensus sequence. Note that if you create new motifs that are not part of collections, you must select to display "Motifs" from the drop-down menu in the Motifs Panel in order to see the motifs listed in the panel.

In a protocol you can create new motifs with the new operation as shown below. The argument should be a semicolon-separated list of "property:value" pairs. Semicolons within property values can be escaped with backslash. If property values are lists the entries should be separated with commas.

# Creates a new motif named MyMotif with the specified properties
MyMotif = new Motif( Property1:value1; Property2:value2; ... ; PropertyN:valueN )

The only required property is the binding motif itself which can be specified either as an IUPAC consensus sequence ("CONSENSUS" property) or as a matrix model (by setting the properties "A", "C", "G" and "T"). Other standard properties include: SHORTNAME, LONGNAME, CLASS, ORGANISMS, PART, ALTERNATIVES, PARTNERS, QUALITY, FACTORS, EXPRESSION, DESCRIPTION and GO-TERMS (these names must be uppercase). All other specified properties are regarded as being non-standard, user-defined properties.

Examples
# Creates the new motif M00001 with IUPAC consensus sequence "srACAGGTGkyG" and short-name "myoD"
M00001 = new Motif(CONSENSUS:srACAGGTGkyG ; SHORTNAME:myoD)

# Creates a new motif with a specific matrix model (CACGsG)
# The matrix values can be frequencies (like here) or counts
M00002 = new Motif( A:0.0,1.0,0.0,0.0,0.0,0.0; C:1.0,0.0,1.0,0.0,0.5,0.0;
                    G:0.0,0.0,0.0,1.0,0.5,1.0; T:0.0,0.0,0.0,0.0,0.0,0.0)

Motif manipulation

MotifLab v2 introduced several functions to derive new motifs based on existing motifs using the extract operation, including functions to reverse complement a motif, trim bases off the ends or even extend the motif with additional bases. These functions can be applied to both single motifs and collections (the syntax is almost identical in the two cases, except that the names of the single motif functions usually contain the word "motif" somewhere). When transforming a single motif in this way, the result must always be assigned to a new explicitly named motif object. However, when the operation is applied to a collection, the original motifs will be replaced with the new transformed motifs unless you specify a "name suffix" that can be used to derive sensible names for all the new motifs.

# Creates the new motif M00001_RC as the reverse complement of M00001
M00001_RC = extract "reverse motif" from M00001 as Motif

# Reverse complements all motifs in the TRANSFAC_Public motif collection (replacing the originals)
New_Motifs = extract "reverse" from TRANSFAC_Public as Motif Collection

# Takes all the motifs from the TRANSFAC_Public motif collection and creates a reverse complement
# motif for each one. The new motifs have names based on the original motifs with the added suffix "_RC"
# (e.g. the complement of motif M00001 will be called M00001_RC). The original motifs are kept intact.
New_Motifs = extract "reverse; name_suffix=_RC" from TRANSFAC_Public as Motif Collection

The following examples demonstrate all of the motif manipulation functions as applied to a full collection.
Remember to add the ";name_suffix=X" option after the extract function if you want to create new motifs rather than transforming the current.
# Reverse complements the motifs
New_Motifs = extract "reverse" from TRANSFAC_Public as Motif Collection

# Inverts the motifs by reversing the order of the positions (reversing without complementing)
New_Motifs = extract "inverse" from TRANSFAC_Public as Motif Collection

# Randomly reorders all the rows in each binding matrix
New_Motifs = extract "shuffle" from TRANSFAC_Public as Motif Collection

# Rounds all the values in the matrix to the nearest integer value
# This can be useful for cleaning up count matrices with rounding errors
New_Motifs = extract "round" from TRANSFAC_Public as Motif Collection

# Expands each motif by adding the bases 'AAA' to the beginning and 'TTT' to the end.
# Use a star (*) or the number 0 to denote an empty string if you only want to add to one side.
# The resulting motifs will have matrices in frequency format.
New_Motifs = extract "flank:AAA,TTT" from TRANSFAC_Public as Motif Collection

# Trims each motif by removing 3 bases from the beginning and 4 from the end
New_Motifs = extract "trim:3,4" from TRANSFAC_Public as Motif Collection

# Trims degenerate flanks from motifs having a specific core surrounded by bases with high variation
# It works inwards from both ends and removes bases until it encounters a base
# with an IC-content that is greater than or equal to the specified threshold (here 0.5)
New_Motifs = extract "trim flanks:0.5" from TRANSFAC_Public as Motif Collection

Motif tracks

A motif track is a special type of region track where the regions correspond to motif sites. In these tracks the type property of each region site corresponds with the name of a motif. Motif tracks include meta-data properties that specifically tag them as such, and they can be recognized in the Features Panel by having names displayed in boldface font. Also, if you point the mouse at a motif track in this panel, the appearing tooltip will describe the dataset as being a "[Region Dataset, Motif track]".

Some operations, like motifDiscovery and motifScanning will always return motif tracks, and if you import a region track from any source, MotifLab will first check if it could potentially be a motif track and mark it as such if at least half of the first ten regions correspond to known motifs. You can also try to manually convert a regular region track into a motif track by right-clicking on a track in the Features Panel and selecting "Convert to Motif Track" from the context-menu.

A motif region or motif site is a region within a motif track that represents the location of a transcription factor binding site by having a type property that corresponds to the name of a known Motif model.


Motif tracks are given special treatment by the GUI's track visualizer, both with respect to how the motif regions themselves are drawn and also how their tooltips are rendered when you point the mouse at a motif region.

Motif match logos
When the track height and zoom level of the sequence in the sequence window allows it, motif regions will be drawn with motif match logos overlayed on top of the regions. These logos illustrate both the model of the motif itself and how well the model matches the DNA sequence at this particular location. They are inspired by the "Sequence logo" concept introduced by Schneider and Stephens ("Sequence logos: a new way to display consensus sequences", Nucleic Acids Research, Oct 1990, 18(20):6097-6100). The logo is created from the matrix model representation of the motif. For each motif position, the letters for the four bases are first drawn on top of each other. They will be sorted according to their frequency in the model, with the most frequent base on top. Each base letter is also scaled according to its frequency, so if e.g. the frequency of base "G" is 0.46, then the height of the letter G will take up 46% of the stack height, originally. Next, the whole stack of four base letters is scaled once again according to information content, so positions with higher information content (i.e. those whose frequency distribution is more skewed towards a single nucleotide) will have a higher stack. On the other hand, positions that have an almost uniform distribution between the four bases will have a very short height. In addition, the matching base at each position will be colored according to its base's preferred color, whereas the other bases will be drawn in a gray color. Consider as an example the motif region for "M00184 - MyoD" that the mouse cursor is pointing at in the image above. In the last position of this site, the motif model has an almost equal preference for the bases C and T, with C slightly preferred over T (since the most frequent base according to the model - here C - is drawn on top). However, the DNA sequence contains a "T" in this position rather than the most preferred base "C", as indicated by the fact that the T is colored red in the logo while the C is gray. The "colorfulness" of the match logo thus gives an indication of how well a motif model actually matches the DNA sequence at that location. The more tall letters drawn in vibrant colors the logo contains, the better the match between the motif and the sequence. Logos with lots of gray, on the other hand, indicate worse matches. It should be noted that the motif logo colors are not based on the match between the motif logo and the DNA track here seen above the motif track. The DNA sequence used when comparing the motif model to the sequence is taken from a property of the region itself, named "sequence" (this property can be inspected by double-clicking on a region). This "sequence" property is usually set automatically in each region when motif tracks are created based on DNA tracks (using motif discovery or motif scanning tools). Regions that lack this "sequence" property will not be drawn with overlayed motif match logos at all.


The visualization of motif sites and their tooltips will differ somewhat depending on whether the motif track is visualized in contracted mode or expanded mode, and the differences between these two modes are described below. You can switch between these modes by selecting a region track in the Features Panel and pressing the X or E keys, or by right-clicking on a track and selecting the mode from the context menu.

Expanded Mode
In expanded mode (shown in the image above), overlapping motif sites will be drawn beneath each other so that every region is clearly separated from the other regions and distinctly visible in the track.
  • The "visualize score" option has no effect in this mode. All motif sites are drawn with the same height.
  • If the "visualize strand (orientation)" option is enabled, the boxes of motif sites will be drawn with protrusions indicating their orientation (but only in zoom levels 1000% and above)
The tooptip for motif regions in expanded mode will include the following information (from top to bottom. See also example in figure above):
  • The position that the mouse currently points to within the sequence followed by the name of the track (in boldface)
  • The name (identifier) of the motif that the mouse is pointing at followed by the "long name" of this motif
  • The third line contains additional information about this particular motif site:
    • The sequence span (length) of the region (in bp)
    • The orientation of the motif site
    • The score of the motif site
  • The fourth line again shows the motif match logo where the base that the mouse is pointing to in the motif is highlighted with a pink rectangle. In front of the motif logo is a pair of nested boxes, where the outer box is white and the inner box has the color associated with the motif.

Contracted Mode
In contracted mode, all the regions are visualized on the same line and overlapping regions will thus be drawn on top of each other.
  • When the "visualize score" option is enabled, the height of the regions will be scaled according to their scores.
  • If the "visualize strand (orientation)" option is enabled, the track will be divided into two vertical halves by a middle line. Boxes drawn above this middle line indicate regions that have the same orientation as the orientation that the underlying sequence is currently visualized in. Regions that have the opposite orientation will be drawn with boxes below the middle line. Regions with undetermined orientation are drawn both above and below the line.
The tooltip shown when pointing at a position containing one or more regions will contain the position of the mouse pointer followed by the name of the track (in boldface). This information is then followed by one line for each region that overlaps with this position. Each line starts with a pair of nested boxes, where the outer box is white and the inner box has the color associated with the motif for that region. These boxes are followed by the match logo for the motif site where the position that the mouse currently points at is highlighted with a pink rectangle in the motif logo. If more than one region overlaps at this position, the logos for the different overlapping regions are aligned. The logos are followed by the name (identifier) of the motif, the motif's "long name", the region orientation, region size (in bp) and finally the region score.



Module

The Module data type (also called composite motif or cis-regulatory module (CRM)) is used to model clusters of binding motifs that occur in relative proximity to each other and bind multiple TFs that cooperate in regulating one or more genes. The definition of a module can be loose (e.g. motifs A, B and C should all occur within a span of N bp) or very strict (e.g. the motifs A, B and C should occur in order with motif B located between 20 to 23 bp after motif A followed by motif C between 35 to 40 bp after motif B; in addition motif B should occur in reverse orientation relative to A and C).

Modules can either be defined manually, they can be discovered "de novo" from sequence data (either DNA tracks or motif tracks) by module discovery programs, or they can be derived based on interaction partner annotations in motifs. Once a collection of modules has been defined, the moduleScanning operation can be employed to search for instances of these modules in either motif tracks or DNA tracks (depending on the particular module scanning program used). Both the moduleDiscovery and moduleScanning operations will return module tracks, which are a special kind of region track where the type property of the regions correspond to module names. The regions of a module track are nested regions where the top-level regions correspond to the full module segment and the child regions correspond to the component motifs of the module.

Module definition

The definition of a module consists of two parts:
  • A set of component motifs (sometimes also called module motifs or meta motifs)
  • A set of constraints (optional)
Component motifs
A module represents a group of individual binding motifs which are referred to as the component motifs of the module. For example, in a module consisting of binding motifs for the interacting transcription factors SP1, NF-Y and SRF, the component motifs will of course be SP1, NF-Y and SRF. However, in MotifLab these component motifs do not correspond directly to the motif data type. Rather, component motifs represent an intermediate level of "meta-motifs" that are basically sets of equivalent binding motifs for the same TF. The reason for this is that a single TFs can be associated with multiple motif models (for example, the Heat Shock Factor has 12 different motif models in TRANSFAC Public alone!). So, if factor A is represented by N motifs and factor B has M motifs, one can simply define a single module for factors A and B rather than having to define N×M individual modules covering every possible combination of motifs for these two factors.
The figure on the right shows a module as it is displayed in the Motifs Panel. The structure of the module is visualized in a three-level hierarchy. The top-level is the module itself, named MOD0001 The second level is made up of 3 component motifs, named respectively SP1, NFY and SRF, and the third level lists the basic motif models associated with each of the component motifs (three models for SP1 and SRF and four models for NFY). Note that the colors used for the component motifs need not correspond to the colors for the individual motif models at the level below.

Even thought the definition of the module allows its component motifs to be represented by multiple motif models, a specific module region (the occurrence of module site within a region track) will only have one motif model corresponding to each component motif site. For example, the module MOD0001 could be made up from TFBS corresponding to the motifs M00008 (SP1), M00209 (NF-Y) and M00152 (SRF) at one module site, but be made up of TFBS sites for M00255 (SP1), M00185 (NF-Y) and M00152 (SRF) in a different location. Since it is common for different motifs representing the same TF to have overlapping sites in a motif track, it would also be natural for the same module to have multiple overlapping sites representing different combinations of the underlying motif models. For example, if the MOD0001:SP1-NFY-SRF module existed at a particular location in the sequence and all of the underlying motif models matched their respective TF sites (3 models for SP1 and SRF and 4 for NF-Y), a straight-forward module scanning method could potentially predict 3x4x3=36 overlapping module sites for the same MOD0001 module at this location to cover all possible motif combinations.
Note that it is also technically permissible for a module site to lack some of the component motifs.


Module constraints
In addition to the component motifs, the module can also be fitted with optional constraints. These constraints can either be global (applying to the module as a whole) or local (applying to a single component motif or the space between two component motifs).
    Global constraints:
  • Max span: The maximum width of the whole module. All the component motifs of the module must be located within a sequence window of this size
  • Ordered: In an ordered module, the component motifs must appear in a specified order, whereas in an unordered module they can appear in any order. If the module is ordered, additional constraints can be placed on the distances between pairs of component motifs
    Local constraints:
  • Motif orientation: It can be specified that a component motif must have a certain orientation (direct or reverse) relative to other component motifs. Note that since this is relative, at least two motifs must have this constraint in order for this to make sense
  • Distance between motifs: In an ordered module, it is possible to place constraints on the distance between two consecutive motifs. This could be a minimum distance, a maximum distance or both. Distances can also be negative (i.e. allowing overlap)

Module properties

A list of standard module properties are described below. In addition to these, modules can also have extra user-defined properties.
PropertyDescription
IDThe ID or identifier of a module is the same as the name of the module data object. This is set when the data object is created and can not be changed later. The ID is usually in the form of an incremental identifier (e.g. MOD1043), but it could also be a more descriptive name (as long as it adheres to the naming rules for data objects)
Component motifsThe "meta-motifs" (motif equivalence sets) that represent binding motifs for each individual binding factor in the module
CardinalityThe number of component motifs in the module (this is a derived property).
Max lengthAlso called "max width" or "max span". An optional global constraint specifying the maximum number of sequence bases that the module is allowed to span
OrderedAn optional global constraint specifying whether or not the component motifs must appear in a specific order within the DNA sequence
GOA set of gene ontology terms that describe the module


Creating a module in the GUI

You can create a new module by selecting "Add New ⇒ Module" from the "Data" menu or alternatively pressing the "+" button in the Motifs Panel and selecting "Module" from the drop-down menu. Note that the modules you create will only be displayed in the Motifs Panel if the drop-down box above the panel is set to "Modules". Or if the modules are part of collections or partitions you can also see them by selecting these two options.

1) Specifying the component motifs
In the Module dialog, press the "Add motif" button to add a new component motif to the module. New motifs will be added to the end (right-hand side) of the module. By default, the module will be ordered, which is indicated with angular connector lines between the component motifs. If you uncheck the "Motifs must appear in order" box, the module will be unordered and the connector lines will not be displayed. It is currently not possible to rearrange the order of the component motifs within a module. You can remove a component motif by selecting it and pressing the "remove button". To select a component motif, simply point at the motif box (or above or below it) so that the box border changes to a red color, and then click. The selected portion of the module will be highlighted with a blue background, and all the settings that apply to this component of the module will be enabled in the dialog (such as name, select motifs, color and orientation).


Newly added component motifs will be given generic names on the form "MotifN", and the name will be flanked by stars in the motif box to indicate that the motif has not been associated with any actual motif models yet (e.g.  * Motif1 * ). You can change the name of a component motif in the "Name" text field of the dialog and also change the color by clicking the "Color" button.


To associate a component motif with actual motif models, either select a component motif and press the "Select motifs" button or double-click on the component motif in the visualization. This will bring up a motif browser where you can select which motifs models to use. Once a component motif has been assigned at least one model, the stars flanking the name in the motif box will disappear. You can hover the mouse over a motif box to see which motif models have been selected for that component. Note that all component motifs must have been assigned at least one basic motif, or else you will not be able to press the "OK" button to close the dialog and create the module.


2) Setting distance constraints
You can specify a global max length for the module by checking the "Max span (bp)" box and then setting a number in the adjecent field. This constraint is taken to mean that all the component motifs of the module should be located within a sequence window of this size.

If the module is ordered you can also specify distance constraints between adjecent pairs of component motifs. To specify such a constraint, simply point to a connector line between motif boxes (the line should turn red), and click to select it. The selected connector should then be highlighted with a blue background, and the settings that apply to this connector will be enabled in the dialog. When you enter numbers into the min distance and max distance fields, these values will appear in brackets above the connector line. It is possible to leave one of the limits blank (either min or max) to say the the distance should be unconstrained in that direction. This will be marked with an asterisk in the brackets, as can be seen for the connector between the NFY and SRF motifs in the figure below. If both limits are left blank, the constraint will be removed.


3) Setting orientation constraints
It is possible to declare that the component motifs should occur in specific orientations relative to each other. To set an orientation constraint on a component motif, first select it in the visualization and then click on one of the colored arrow buttons underneath the "Add motif" button. If you select the "Direct orientation" button, a green right arrow will also be displayed above the component motif box in the visualization (see motif SP1 in the figure below), and if you select the "Reverse orientation" a red left arrow will be displayed above the motif box (motif SRF in the figure). If you select the yellow "any orientation" bidirectional arrow, the orientation constraint will be removed from the motif and no arrows will be displayed above the motif box (motif NFY in the figure).

Note that a direct orientation constraint does not imply that the motif has to be located on the direct strand (and likewise for reverse orientation). It simply means that the underlying motif model must match the DNA sequence in its default (not reverse) orientation, but this could potentially occur on either strand of the DNA sequence. Since orientation constraints are relative, they only make sense if at least two of the component motifs have such constraints.


Creating a module in a protocol

A new module can be created in a protocol script with the following general syntax:
MOD0001 = new Module(... list of property arguments ... )

The arguments are specified as a semicolon-separated list of property definitions, where the name of the property is case-sensitive. The first property argument must be CARDINALITY and its value must match the number of MOTIF arguments. The standard property arguments are described in the table below. Properties that are not in this table are considered to be user-defined properties and must be specified as "propertyname:value" pairs.

PropertyDescription
CARDINALITYThis defines the number of component motifs in the module on the format: CARDINALITY:<n>
This must be the first argument!
MOTIFDefines a component motif of the module on the format: MOTIF(<name>)[(<orientation>]{<list of motifs>}
The "MOTIF" prefix is followed directly by a name for the component motif in parentheses. This is then followed by the orientation of the component motif in brackets. The orientation can either be "+" (direct orientation), "-" (reverse orientation) or "." (for unordered motifs). Finally, the basic motifs that make up this component motif is listed (comma-separated) within a pair of curly braces.
For example, a direct-oriented component motif for the SRF transcription factor based on the three TRANSFAC models M00215, M00152 and M00186 can be defined as: MOTIF(SRF)[+]{M00215,M00152,M00186}
Note that the "MOTIF" argument can be repeated several times, and the number of times it is used must match the CARDINALITY of the module.
ORDEREDSpecifies that the component motifs of the module should be ordered. The order is based on the "MOTIF" arguments.
UNORDEREDSpecifies that the component motifs of the module should be unordered. This is the default unless ORDERED is specified.
MAXLENGTHDefines an optional maximum span for the module on the format: MAXLENGTH:<number of bases>
DISTANCEDefines a distance constraint between two (consecutive) component motifs on the format:
DISTANCE:(<motif1>,<motif2>,<min distance>,<max distance>)
This only makes sense if the module is ORDERED. The minimum distance can be negative to allow overlapping motifs. If you only want to constrain one of the limits in the range (either min or max) you can set the other limit to UNLIMITED or *. This argument can be repeated several times to define distance constraints between different pairs of motifs.
For example, if you want the distance between the two component motifs "SRF" and "NFY" to be at least 5bp, you can specify the constraint: DISTANCE(SRF,NFY,5,*)
GO-TERMSDefines a set of GO-terms to be associated with the module on the format: GO-TERMS:<comma-separated list of terms>
The GO terms are numbers that can optionally be prefixed by "GO:" (case-insensitive). The numbers do not have to be padded with zeros. The strings "GO:000290" and "290" will thus refer to the same term.


Module tracks

A module track is a special type of region track where the regions correspond to module sites. In these tracks the type property of each region site corresponds with the name of a module. Module tracks include meta-data properties that specifically tag them as such, and they can be recognized in the Features Panel by having names stylized in both bold and italics. Also, if you point the mouse at a module track in this panel, the appearing tooltip will describe the dataset as being a "[Region Dataset, Module track]".

Some operations, like moduleDiscovery and moduleScanning will always return module tracks, and if you import a region track from any source, MotifLab will first check if it could potentially be a module track and mark it as such if at least half of the first ten regions correspond to known modules. You can also try to manually convert a regular region track into a module track by right-clicking on a track in the Features Panel and selecting "Convert to Module Track" from the context-menu.

A module region or module site is a region within a module track that represents the location of a cis-regulatory module by having a type property that corresponds to the name of a known Module model. A module region is most often also a nested region where the child regions correspond to the individual TF binding sites that make up the module. These nested regions would then be motif regions whose type properties correspond to names of known Motif models. For example, in the figure below, a module model named MOD0001 is composed of two component motifs – HSF and TATA – with 9 and 6 associated motif models respectively. The particular module site corresponding to this module shown at the top of the track on the right would have the value "MOD0001" for its type-property and two additional properties called "HSF" and "TATA" that would point to two nested motif regions corresponding to the "M00471-V$TBP_01" and "M00147-V$HSF2_01" motif models respectively. (Note, however, that it is technically allowed for a module site to be missing some or all of the component motifs defined in the module).


Like motif tracks, module tracks are given special treatment by the GUI's track visualizer, both with respect to how the module regions themselves are drawn and also how their tooltips are rendered when you point the mouse at a module region.

In MotifLab version 1.x, the regions of module tracks (and also other nested tracks) would be drawn in two steps. First, a box would be drawn to represent the full module region, and this would be colored according to the chosen color for the module (at least if the "color by type" option was enabled for the track; if not, the module box would be drawn in the selected track color). Second, the individual TFBS of the module (the nested regions) would be drawn on top of this background box in their respective motif colors. An example of this style is shown for the top-most region in the figure above, where the module site spans the full 23bp sequence segment GATTTATAccaaccAGATCTTTCT. The left-hand side of the module site is made up of a TFBS for the TBP factor (green) and the right-hand side is a site for the HSF factor (violet). The middle part "CCAACC" is just inter-motif background sequence where the color of the module itself shines through in pink. The visibility of all module sites corresponding to the same module could be toggled by clicking the colored box in front of the module in the Motifs Panel, and it was also possible to toggle the visibility of the constituent TFBS sites independently of the module by changing the visibility of the motifs.

Version 2.0 of MotifLab introduced more ways to visualize modules with different styles of connectors between the component motifs. In addition to the normal background box, modules can now be visualized with straight line segments connecting adjecent motifs, or with angled lines (see second module site in figure above), with curves or with "ribbons". The connector style can be selected by right-clicking on a module track (or other nested track) in the Features Panel and selecting the connector from the context menu. Alternatively, you can select a track (or multiple tracks) in the Features Panel and press the "L" key to cycle through the different connectors. If the "visualize strand (orientation)" option is enabled for a track, the angled line, curved line and ribbon connectors will be drawn pointing upwards if the orientation of the modules correspond with the orientation that the underlying sequence is currently visualized in (i.e. the module is "oriented towards the right-hand side of the screen"). If they have the opposite orientation (module is oriented "towards the left"), the connectors will be drawn pointing downwards.

The visualization of module sites and their tooltips will differ somewhat depending on whether the module track is visualized in contracted mode or expanded mode, and the differences between these two modes are described below. You can switch between these modes by selecting a region track in the Features Panel and pressing the X or E keys, or by right-clicking on a track and selecting the mode from the context menu.

Expanded Mode
In expanded mode, overlapping module sites will be drawn beneath each other so that every region is clearly separated from the other regions and distinctly visible in the track.
  • The "visualize score" option has no effect in this mode. All modules and TFBS sites are drawn with the same height.
  • If the "visualize strand (orientation)" option is enabled:
    • The boxes of the modules' constituent TFBS sites will be drawn with protrusions indicating their orientation (but only in zoom levels 1000% and above)
    • If the straight line connector style is chosen, the connector lines will be decorated with small arrows indicating the orientation of the module itself
The tooptip for module regions in expanded mode will include the following information (from top to bottom. See also example in figure above):
  • The position that the mouse currently points to within the sequence followed by the name of the track (in boldface)
  • The name of the module that the mouse is pointing to
  • The third line contains additional information about this particular module site:
    • The cardinality of the module model (after the slash) preceeded by the number of TFBS sites that actually appear within this particular module region (before the slash)
    • The sequence span (length) of the full module site (in bp)
    • The orientation of the module site (not the orientation of its constituent TFBS sites)
    • The score of the module site
  • The fourth line shows a visual representation of the module model. If the module is ordered, the boxes representing the component motifs will be drawn with angled connector lines. If a pair of adjacent motifs has an associated distance constraint, this will be indicated with a pair of brackets above the connector.
  • The last part of the tooltip contains information about each constituent motif of the module (as shown in the visualization on the line above), with each box there corresponding to one TFBS line (in the same order). Each TFBS line starts with a pair of nested colored boxes. The outer box has the color of the component motif and the inner box has the color of the actual motif that represents this component at this particular module site. This is followed by the motif match logo for this motif and then the name and size of the motif. Similarly to motif tracks, if the mouse pointer points to a base position within a TFBS, that position will be hightlighted with a pink rectangle in the corresponding motif logo. For example, in the figure above, the mouse points to the middle "A" in the TFBS site for the HSF factor, so this position is indicated with a rectangle around the "A" in the corresponding motif logo shown in the tooltip.

Contracted Mode
In contracted mode, all the regions are visualized on the same line and overlapping regions will thus be drawn on top of each other.
  • When the "visualize score" option is enabled, the height of the constituent TFBS sites within the modules will be scaled according to their scores. However, the module regions themselves will always be drawn at full scale.
  • If the "visualize strand (orientation)" option is enabled the track will be divided into two vertical halves by a middle line:
    • The boxes of the modules' constituent TFBS sites will be drawn above the middle line if their orientations correspond with the orientation that the underlying sequence is currently visualized in. If they have the opposite orientation they will be drawn below the middle line. The boxes of the modules regions themselves will always be drawn at full height.
    • Connector lines will be drawn in the middle so that their end points align with the middle divider line. Also, if the orientation of the module region corresponds with the orientation that the underlying sequence is currently visualized in, the angled, curved and ribbon connectors will be drawn upwards, or else they will be drawn downwards. However, if strand orientation is not visualized, the connector lines will always be drawn upwards from the bottom of the track.
When the mouse points at a module site that is not overlapping any other module sites, the tooltip that is displayed will be the same as the one shown in expanded mode (as explained above). However, if the mouse points at a location with multiple overlapping module sites, a different tooltip will be shown containing the following information:
  • The position that the mouse currently points to within the sequence followed by the name of the track (in boldface)
  • If all the module sites have the same module type, a visual representation of the module is included on the second line (see above). If the sites are heterogeneous, this is skipped
  • The final part of the tooltip contains information about each of the overlapping module sites, with one line per site with the following information:
    • Each line starts with a box which is colored after the module associated with that site. If the mouse points to a position within a TFBS site for that module, the color associated with the motif for that TFBS is shown in a smaller nested box.
    • The name of the module
    • The cardinality of the module model (after the slash) preceeded by the number of TFBS sites that actually appear within this particular module region (before the slash)
    • The sequence span (length) of the full module site (in bp)
    • The orientation of the module site
    • The score of the module site



Collection

Collections are used to refer to (sub)sets of existing data objects or to create/import several new objects with a single operation. Collections usually always refer to homogeneous sets of data objects of one the three basic data types (motif, module and sequence) and specific subtypes of collections exist for these types called respectively Motif Collection, Module Collection and Sequence Collection. Although rarely needed, Text Variables can be used to specify more general collections that are not limited to contain data objects of the basic types.

Creating Collections

Collections can be created manually by explicitly listing which data objects to include in the collection, or by selecting objects based on some specified criteria. Collections can also be based on or extracted from some other data objects, typically Maps and Analyses. More complex collections can be made by applying set operations (union, intersection etc.) to individual collections. The procedures to create collections described in this section apply to all types of collections. For additional ways to create Motif Collections, Module Collections and Sequence Collections, refer to their respective sections.
List of entries
From the Collections' GUI dialogs you can select which entries to include by going to the "Manual Selection" tab and checking off the boxes in front of your chosen items (right-clicking on the list will bring up a context-menu with more options to include and exclude items or invert the collection). Alternatively, the "From List" tab lets you to type in the names of items to include and also allows for the use of wildcards and range operators. For example, the star wildcard operator (*) stands for "any string of letters or numbers" so if you enter "MA01*" the collection will include all data items whose names begin with "MA01" (of the relevant type). Many motifs and sequences have names/identifiers on a specific format containing some letters and an incremental number. The colon range operator allows you to specify a subset of items based on a numeric range within the identifier. For example, the range "MA0100b:MA0200b" will include all items whose names start with "MA", ends with "b" and have a number in the middle between 100 and 200 (the prefixes and suffixes around the number are optional but must be the same for all the items, and the numbers need not have the same number of digits). When listing items, the names can refer to either a single basic data object (motif,module,sequence), another collection, or a cluster within a Partition (using the notation "PartitionName->ClusterName"). Note that the "From List" tab allows entries to be separated by either commas, semicolons or spaces/newlines, but in a protocol script they must be separated by commas (they will be converted automatically in "record mode").

If you use wildcards, range operators or refer to collections or clusters in the "From List" tab (i.e. refer to multiple data items with one entry), the list can either be parsed and resolved immediately or this can be delayed to when it is first needed ("resolved in protocol"). The second option is now the default behavior but it can be controlled with a checkbox in the "From List" tab. If you choose to "resolve immediately" (by unchecking "resolve in protocol"), then immediately after you press the "OK" button to create the collection, MotifLab will go through all the listed entries to find out exactly which of the currently defined motifs, modules or sequences to include in the collection. This explicit list of basic data objects will then constitute the constructor string for the collection, which is a description of how the collection should be created. This constructor string will be included in the protocol (if you are currently in "record mode") and also as meta-data in the newly created collection itself. (By the way, you can see the constructor for a data object by selecting it in one of the data panels and pressing the "P" key. The constructor will be shown in the log panel.) If you rather choose to "resolve in protocol", the constructor string will instead be the exact text you entered in the "From List" tab (with whitespace and semicolons replaced with commas) prefixed by "List:". The consequence of "resolving immediately" will thus be that entries in the collection are fixed in the protocol even before it is executed, whereas with "resolve in protocol" the final entries in the collection will be decided dynamically when the protocol is run based on the currently defined data objects and contents of other collections.

# Creates a Motif Collection with the motifs M00007, M00013 and M00014
Collection1 = new Motif Collection(M00007, M00013, M00014)

# Creates a Motif Collection containing all motifs from the TRANSFAC collection
# plus 3 additional JASPAR motifs
Collection2 = new Motif Collection(TRANSFAC, MA0004, MA0006, MA0007)

# Creates a Motif Collection containing all motifs from the cluster "Upregulated"
# within the partition "Significant"
Collection3 = new Motif Collection(Significant->Upregulated)

# Creates a Motif Collection containing all currently defined motifs
Collection4 = new Motif Collection(*)

# Creates a Sequence Collection containing all sequences whose names begin with either "ENSG" or "ENSMUS"
Collection5 = new Sequence Collection(ENSG*, ENSMUS*)

# Creates a Module Collection containing the modules MOD0005, MOD0006, MOD0007 and MOD0008
Collection6 = new Module Collection(MOD0005:MOD0008)
Set operations
Set operations can be used to create new collections based on other collections (or single entries or partition clusters). Set operations are processed "left-to-right", so each new entry is processed relative to the collection as it is currently defined by the entries proceeding it. Note that set operators must be placed immediately before the collection it refers to (no space inbetween), and commas must be used between entries in protocols. For example, in a protocol the intersection between collections A and B must be written as "A, &B" and not "A & B".
  • Union: To create a union between two or more collections, simply list them after each other (no special union operator exists)
  • Intersection: Prefix a collection with ampersand (&) to create an intersection between the current entries and the new entry
  • Set difference: Prefix a collection with minus (–) to substract the entries in that collection from the current entries
  • Complement: Prefix a collection with an exclamation mark (!) to refer to all entries that are not in that collection
  • XOR: This operation cannot be done directly but can be performed by first creating two collections for the union and intersection respectively and then subtracting the intersection from the union
# Creates a Motif Collection which is the union of motifs in the collections Col1, Col2 and Col3
Collection1 = new Motif Collection(Col1, Col2, Col3)

# Creates a Motif Collection containing all motifs present in both Col1 and Col2 (intersection)
Collection2 = new Motif Collection(Col1, &Col2)

# Creates a Motif Collection containing all motifs present in both Col1, Col2 and Col3 (intersection)
Collection3 = new Motif Collection(Col1, &Col2, &Col3)

# Creates a Motif Collection containing all motifs from either Col1 or Col2 that are also in Col3
Collection4 = new Motif Collection(Col1, Col2, &Col3)

# Creates a Sequence Collection containing all sequences except those in Upregulated
Collection5 = new Sequence Collection(*, -Upregulated)

# Creates a Sequence Collection containing all sequences except those in Upregulated (using 'complement')
Collection6 = new Sequence Collection(!Upregulated)

# Creates a Motif Collection containing all motifs that are in either Col1 or Col2 but not in both sets
# This XOR operation is accomplished via two intermediate collections (here temporary data objects)
_unionSet = new Motif Collection(Col1, Col2)
_intersectionSet = new Motif Collection(Col1, &Col2)
Collection7 = new Motif Collection(_unionSet, -_intersectionSet)
Collections based on properties
Motifs, modules and sequences have both standard and user-defined properties that can be used to create collections based on a defined condition. You can, for instance, make a collection based on all motifs with IC-content higher than 12.0, or a collection with all sequences that reside on chromosome 2.
In the GUI you can create such collections by selecting "Add New ⇒ Collection" from the "Data" menu and then go to the "From Property" tab.
The general syntax for creating such collections in protocols is the following:

MyCollection = new <Type> Collection(Property: <property name> <comparator> <target value>)

The property name is selected with an editable drop-down menu in the GUI and it can be enclosed in quotes in the protocol. The available comparator functions vary depending on whether the property is numeric, textual or boolean. The target value can either be a single value or multiple values. In the protocol, multiple values must be separated by commas, and individual values can optionally be enclosed in quotes. In the GUI there is a big text box where you can enter multiple target values which may be separated either by newlines or commas, but values should not be quoted in the GUI.
  • Numeric properties
    If the property is numeric, the target value should be one or more numeric values. Numeric target values can either be literal numbers or numeric data objects (Numeric Variables or Numeric Maps). Available comparator functions are: = , <> , < , <= , > , >= , in, not in
    The range comparators "in" and "not in" require two target values denoting respectively the minimum and maximum values in the range (inclusive). If you use the equals comparator (=) the property value can be compared against a list of target values and the data element will be included in the collection if its property value equals at least one of the values in the list. For all other comparators, only one target value should be supplied.

  • Textual properties
    If the property is textual, the target value could be a single value or multiple values.
    If multiple target values are provided, it is enough for the property to match only one of these in order to satisfy the condition.
    If the text property itself is a list, it is enough that one of the entries in the list matches one of the provided target values.
    Available comparator functions are: equals, not equals, matches, not matches, in, not in
    If the comparators "equals" and "not equals" are used, the condition is satisfied if the value of the property is exactly the same (or not) as the target value (case insensitive).
    If the comparators "matches" or "not matches" are used, the target value(s) should be regular expressions, and the condition is satisfied if the property value matches (or not) the full regular expression. (Hence, if you want to compare against a substring you should surround the target value by ".*" on both sides).
    If the comparators "in" or "not in" are used, the target value should be the name of a Text Variable, and the condition is satisfied if one of the lines in the Text Variable equals (or not) the property value (case insensitive).

  • Boolean properties
    If the property is boolean, the target value should be either "TRUE", "FALSE", "YES" or "NO" (case insensitive).
    Available comparator functions are: = , <>
Note that if a motif, module or sequence does not have a defined value for the property, it will never be included in the collection, even if the comparison function is a negation! Also note that names of standard properties are case-insensitive whereas names of user-defined properties are case-sensitive!

# Creates a collection containing all motifs with IC-content greater than or equal to 12
Collection1 = new Motif Collection(Property: "IC-content" >= 12)

# Creates a collection containing all motifs with sizes in the range 8 to 11 (inclusive)
Collection2 = new Motif Collection(Property: "Size" in 8, 11)

# Creates a collection containing all motifs belonging to the classes "4.4.1.1" or "2.3.2.0"
Collection3 = new Motif Collection(Property: "Classification" equals "4.4.1.1","2.3.2.0")

# Creates a collection containing all motifs whose list of associated binding factors
# includes names containing the words "CREB" or "NF-Y" as substrings
Collection4 = new Motif Collection(Property: "Factors" matches ".*CREB.*",".*NF-Y.*")

# Creates a collection containing all motifs whose consensus sequences are listed in the Text Variable
Collection5 = new Motif Collection(Property: "Consensus" in TextVariable1)
Collections based on values in Maps
Similarly to how collections can be based on data objects having certain values for specific properties, collections can also be based on data objects having certain values in specific maps. At the moment, only numeric maps can be used for this, but support for text maps will be added soon.
In the GUI you can create such collections by selecting "Add New ⇒ Collection" from the "Data" menu and then go to the "From Map" tab.
The general syntax for creating such collections in protocols is the following:

MyCollection = new <Type> Collection(Map: <map name> <comparator> <target value>)

The name of the map variable is selected with a drop-down menu in the GUI.
The available comparator functions are: = , <> , < , <= , > , >= , in
The target value should be a single numeric value which can be either a literal string or a numeric data object. If the comparator is "in" the target value should be two numeric values denoting respectively the minimum and maximum value in the range (inclusive). In the protocol the range values must be separated by a comma and enclosed in brackets.

# Creates a collection containing all motifs with a value less than or equal to 0.05 in the "Pvalue" map
Collection1 = new Motif Collection(Map: Pvalue <= 0.05)

# Creates a collection containing all motifs with values between 20 and 32 in the "Support" map
Collection2 = new Motif Collection(Map: Support in [20, 32])
Random collections
Random collections can be constructed with both the new and extract operations, but currently the collection dialogs in the GUI have no way to define them. Hence, you cannot create random collections by selecting "Add New ⇒ Collection" from the "Data" menu, only by extracting random entries from existing collections or by manually typing and executing a new command in the protocol editor. Entries for the new collection can either be sampled from an existing collection or from all currently defined data items of the given type (if no collection is specified). The number of entries to include in the new collection can either be an absolute number or a relative percentage number (value between 0 and 100). If the value is higher than the number of available items, all of them will be included. Non-integer values will be rounded to the nearest integer. Numeric Variables can be used in place of literal numbers.

# Creates a Motif Collection with 10 motifs selected at random from all currently defined motifs
Collection1 = new Motif Collection(Random: 10)

# Creates a random Motif Collection containing 10% of the currently defined motifs
Collection2 = new Motif Collection(Random: 10%)

# Creates a Sequence Collection with 25 random sequences using a Numeric Variable to specify the number
NumVar1 = new Numeric Variable(25)
Collection3 = new Sequence Collection(Random: NumVar1)

# Creates a random Sequence Collection containing one quarter (25%) of the currently defined sequences
NumVar2 = new Numeric Variable(25)
Collection4 = new Sequence Collection(Random: NumVar2%)

# Creates a Motif Collection with 32 entries sampled at random from the JASPAR collection
Collection5 = new Motif Collection(Random: 32 from JASPAR)

# Creates a Motif Collection with half of the motifs from Collection2
Collection6 = new Motif Collection(Random: 50% from Collection2)


# Creates a Sequence Collection by extracting 10 random sequences from the "UpregulatedGenes" collection
Collection7 = extract "random 10" from UpregulatedGenes as Sequence Collection

# Extracts 10% of the sequences the "UpregulatedGenes" at random
Collection8 = extract "random 10%" from UpregulatedGenes as Sequence Collection

# Extracts 40 of the sequences in "UpregulatedGenes" using a Numeric Variable to specify the number
NumVar3 = new Numeric Variable(40)
Collection9 = extract "random NumVar3" from UpregulatedGenes as Sequence Collection

# Extracts 40% of the sequences in "UpregulatedGenes" using a Numeric Variable to specify the number
NumVar4 = new Numeric Variable(40)
Collection10 = extract "random NumVar4%" from UpregulatedGenes as Sequence Collection
Importing collections from files
In the GUI you can import collections from files by selecting "Add New ⇒ Collection" from the "Data" menu and then go to the "Import" tab. Alternatively, you can select "Import Data..." from the "Data" menu and then select your desired collection type from the "Type" drop-down menu in the appearing dialog. The data format of the file is selected from another drop-down menu, and additional format specific argument settings may be defined depending on the format. The file path could either refer to a file on the user's local machine or it could be a URL pointing to a file on the web.
The general syntax for creating such collections in protocols is the following:

MyCollection = new <Type> Collection(File: "<file path>", Format=<data format> {<format arguments>} )

The format specific arguments can usually be skipped if default argument values are acceptable. Indeed, the specification of the data format itself can be left out and the default data format for the type will then be assumed (MotifLabMotif for motifs, MotifLabModule for modules and Plain for sequences).

There are two ways to view the concept of a collection: A collection can either be thought of as a set of references to other data objects (really just a list of names) or one can view the collection as the set of data objects themselves. The first view is like a shopping list saying e.g. "milk, eggs, oranges" and the second view is like a bag containing the actual groceries. This distinction is important to consider when importing collections from files, because, depending on the data format, the files could contain the actual data objects or just their names. If a file contains descriptions of the basic data objects (motifs,modules,sequences) in sufficient detail, then importing the file will also create these objects in addition to creating the collection object. However, if the file only contains names of motifs, modules or sequences, MotifLab assumes that these data objects must already exist and just creates a new collection listing the names in the file (if the data objects do not exist they will not be added to the new collection).

# Imports a file containing JASPAR motifs from a file in MotifLabMotif data format (default for motifs).
# All the motifs described in the file will be created along with a collection named "JASPAR" that contains
# references to all of these motifs
JASPAR = new Motif Collection(File: "C:\data\jaspar.mlx" )

# Imports a file containing ScerTF motifs from a file in RawPSSM data format.
# All the motifs described in the file will be created along with a collection named "ScerTF" that contains
# references to all of these motifs
ScerTF = new Motif Collection(File: "C:\data\scertf.pssm", Format=RawPSSM )

# Imports a collection with supposedly important motifs from a file in "Plain" data format.
# Since this format does not contain descriptions of the motifs themselves but only list their names,
# the referenced motifs must already exist in MotifLab (or they will not be included in the collection).
Important = new Motif Collection(File: "C:\data\important_motifs.txt", Format=Plain )

# Imports a file containing modules in MotifLabModule data format (default for modules).
# Since this data format includes descriptions of the modules and not just a list of their names,
# all the modules described will be created in addition to a collection named "myModules" that contains
# references to all of these modules. A MotifLabModule file could possibly also contain descriptions
# of the motifs within the modules. If this is the case, these motif objects will be created also.
# If the file only contains module descriptions but not motif descriptions, MotifLab assumes that the
# motifs must already exist (or else the modules will not work properly).
MyModules = new Module Collection(File: "C:\data\my_modules.mod" )

# Imports a collection with supposedly important sequences from a file in "Plain" data format
# (This is the default data format for Sequence Collections)
# Since this format does not contain descriptions of the sequences themselves but only lists their names,
# the referenced sequences must already exist in MotifLab (or they will not be included in the collection).
ImportantSequences = new Sequence Collection(File: "C:\data\important_sequences.txt" )

# Imports a collection of sequences from a URL in "BED" data format
# Since the BED format contains information about the location of the sequences, these sequences will be
# created and added to any sequences already existing. Note, however, that new sequences cannot be added
# after Feature Datasets have been defined. The new collection is assigned the name "AllSequences" which
# is actually the name of the default sequence collection which cannot really be created explicitly.
# The command shown below is the only allowed assignment for "AllSequences", but it will only load
# new sequences and add them to the current "AllSequences" not delete to current sequences
# (i.e. it will not replace "AllSequences" entirely with the sequences in the file)
AllSequences = new Sequence Collection(File: "http://somewebsite.com/sequences.bed", Format=BED )

# Imports a collection of sequences from a URL in "Location" data format
# Since this format also contains information about the location of the sequences, these sequences will be
# created and added to any sequences already existing. Note, however, that new sequences cannot be added
# after Feature Datasets have been defined. The new sequences are added to the sequence collection
# "Upregulated" and will also be included in the default sequence collection called "AllSequences"
Upregulated = new Sequence Collection(File: "http://somewebsite.com/genes.bed", Format=Location )

Modifying Collections

Collections can only be created with the operations new and extract, and they cannot really be modified after creation. However, you can achieve the same effect by simply creating a new collection with the same name to replace the older one. If you want to alter a collection relative to its current content you can normally use set operations to accomplish this, e.g. "X = new Motif Collection(X, -Y)" removes motifs Y from the current collection X. In the GUI, you can edit a collection by either double-clicking on it or right-clicking and selecting "Edit ..." from the context menu to bring up the Collection dialog. As mentioned, this will not actually modify the existing collection, but rather create a new one with the same name.

Using Collections

The main use of collections is to limit the application of operations and analyses to a subset of motifs, modules or sequences. Collections are also used to import or define multiple basic data objects in a single operation. The compare collections analysis will compare two collections to determine their overlap. In the GUI you can control the visualization settings for collections of motifs, modules or sequences by right-clicking on a collection and selecting you preferences from the context menu or via keyboard short-cuts (show/hide, set colors, etc.).

# Search for occurences of motifs from the "TRANSFAC" collection in DNA sequences
TFBS = motifScanning in DNA with SimpleScanner {Motif Collection=TRANSFAC, ... }

# Mask repeat regions in the DNA sequence with N's but only for sequences in the "Upregulated" collection
mask DNA with "N" where inside RepeatMasker in collection Upregulated

# Remove all TFBS regions associated with motifs in the "Insignificant" collection
filter TFBS where region's type is in Insignificant

# Delete all sequences in the "Downregulated" collection (as well as the collection itself)
drop_sequences Downregulated

# Determines the overlap between the two collections "Col1" and "Col2"
Analysis1 = analyze compare collections{First=Col1, Second=Col2}

# Analyses the GC-content of a DNA track for the sequences in the "Upregulated" collection
Analysis2 = analyze GC-content{DNA track=DNA, Groups=Upregulated}



Sequence Collection

Sequence Collections are a specific subtype of the general Collection data type that can only contain Sequence objects. Sequence Collections are mainly used to limit the application of operations and analyses to subsets of sequences, but they can also be used to import sequence definitions from a file.

All Sequence Collections will appear in the "Data Objects" panel in MotifLab's GUI. You can create new Sequence Collections by pressing the "+" button in this panel and then selecting "Sequence Collection" from the appearing menu, or you can go to the "Data" menu in the top menu bar and select "Add New ⇒ Sequence Collection".

AllSequences   (The default sequence collection)

MotifLab has a special sequence collection called "AllSequences" which is regarded as the default sequence collection. This collection is always present and it cannot be created or deleted (however, it will be hidden from the "Data Objects" panel in the GUI when it is empty). Neither can its contents be manipulated directly. The "AllSequences" collection will always contain all the currently defined sequences. Newly created sequences will automatically be added to "AllSequences" and deleted sequences will be removed from "AllSequences". Many operations and analyses require you to specify a sequence collection to apply the operation to, but if none are provided, the "AllSequences" collection will normally be assumed and the operation/analysis will thus be applied to all sequences.

Note that similar default collections do not exist for motifs and modules (i.e. there are no "AllMotifs" and "AllModules" collections). Hence, if you want to perform motif scanning with all currently defined motifs you must explicitly create a new Motif Collection containing all motifs and then refer to that collection in the motif scanning tool.

Although collections are normally regarded as unordered sets they are actually implemented as ordered lists even though the order is almost never an issue. Actually, the "AllSequences" collection is the only collection where the order is used for something in MotifLab, and it is also the only collection whose order can be manipulated. When outputting sequences they are normally output in the order they have in AllSequences, and this is also the order used to visualize the sequences in the GUI. You can reorder sequences in the GUI (and hence in AllSequences) by pointing at a sequence to give it focus and then use the CONTROL key plus ARROW UP or DOWN to move it, or right-click on a sequence and select "Reorder Sequences" from the context menu. Sorting sequences (either with the sort tool or the sort display setting) will also reorder sequences in the AllSequences collection.

Creating Sequence Collections

As described in the general section on collections, Sequence Collections can be created by explicitly listing the names of sequences to include, using condititions to select sequences based on property values or values in Numeric Maps, or importing sequence collections from files. In addition, Sequence Collections can also be based on sequence statistics as described below.
Collections based on sequence statistics
The statistic operation can be applied to feature tracks to calculate various statistics, such as counting the number of regions in each sequence, finding the largest value for each sequence in a numeric track or counting the number of A's for each sequence in a DNA track. This operation returns a Sequence Numeric Map with values for each individual sequence. As described in the general section on collections, collections can be created based on their values in Numeric Maps, so you can use the statistic operation to create a map and then create a collection from this map. However, it is also possible to perform this in one step and create a Sequence Collection directly from sequence statistics. (Actually, MotifLab will run the statistic operation in the background to create a map, and then use this to create the collection, but this is done automatically and the map is discarded afterwards).

In the GUI you can create such collections by selecting "Add New ⇒ Sequence Collection" from the "Data" menu and then go to the "From Statistic" tab. Press the "Select" button to define the statistic function (this will actually bring up the same dialog that is displayed for the statistic operation) and use the other menus to select the comparator function and target value(s).
The general syntax for creating sequence collections based on statistics in protocols is the following:

MyCollection = new Sequence Collection(Statistic: (<statistic function>) <comparator> <target value>)

Examples
# Creates a Sequence collection containing all sequences with more than 20 regions in the TFBS track
# This approach uses the statistic operation to create a map and then uses the map to create the collection
TFBS_count_map = statistic "region count" in TFBS
Collection1 = new Sequence Collection(Map:TFBS_count_map > 20)

# Same as above but this time using the statistic constructor directly in the collection
Collection2 = new Sequence Collection(Statistic:("region count" in TFBS) > 20)



Motif Collection

Motif Collections are a specific subtype of the general Collection data type that can only contain Motif objects. Motif Collections are mainly used to limit the application of certain operations and analyses to subsets of motifs, but they can also be used to import motifs from a file or return results from a motif discovery method.

All Motif Collections will appear in the "Motifs" panel in MotifLab's GUI, provided that you have selected to display "Motif Collections" using the drop-down menu in this panel. You can create new Motif Collections by pressing the "+" button in this panel and then selecting "Motif Collection" from the appearing menu, or you can go to the "Data" menu in the top menu bar and select "Add New ⇒ Motif Collection".

Creating Motif Collections

As described in the general section on collections, Motif Collections can be created by explicitly listing the names of motifs to include, using condititions to select motifs based on property values or values in Numeric Maps, or importing motif collections from files. In addition, MotifLab comes bundled with several predefined collections of motifs that can be imported, and Motif Collections can also be based on sequence support in motif tracks.
Predefined Motif Collections
MotifLab comes bundled with several predefined collections of motifs from publicly available databases, including e.g. TRANSFAC Public and JASPAR. In the GUI you can create such collections by selecting "Add New ⇒ Motif Collection" from the "Data" menu and then go to the "Predefined" tab. This will display a list of available collections. To import motifs from a collection, simply select the collection in the list and press "OK" (or double-click on a collection in the list). When you select a predefined collection from the list, the resulting collection object will automatically be named after the chosen motif collection, as shown in the text box at the top of the dialog. If you want to specify your own name for the new collection, you can change it in the text box before pressing "OK".

Importing a predefined collection of motifs will both create the new collection object and also create motif objects for all motifs defined in the collection. If the collection contains motifs with the same name as already existing motifs, the existing motifs will be replaced without notice.

The general syntax for importing predefined motif collections in protocols is:
MyCollection = new Motif Collection(Collection: <name>)

Examples
# Imports motifs from the TRANSFAC Public database
Collection1 = new Motif Collection(Collection:TRANSFAC Public)

# Imports motifs from the Jaspar Core database
Collection2 = new Motif Collection(Collection:Jaspar Core)

You can add your own custom motif collections to the "predefined" list by right-clicking on the collection in the motifs panel and selecting "Save As Predefined" from the context-menu. Enter a name for the collection to use in the list and press "OK".
Collections based on motif occurrences
Motif collections can be based on motifs that have a certain sequence support in a motif track. By sequence support for a motif we mean the number of sequences that contain at least one occurrence of that particular motif. For example, one could create a collection with motifs that occur in at least 20 sequences or in 80% of all sequences.
In the GUI you can create such collections by selecting "Add New ⇒ Motif Collection" from the "Data" menu and then go to the "From Track" tab. First select the motif track from the drop-drop down menu at the top, then select the comparator function (=,<,<=,>,>=,<>,in) and target value from the bottom menus. The target value can be an absolute number or a relative percentage number (in which case the value should be between 0 and 100), and the value can either be a literal number or a numeric data object (Numeric Variable or Motif Numeric Map).
The general syntax for creating such motif collections in protocols is the following:

MyCollection = new Motif Collection(Track: <region track>, support <comparator> <target value>)

Examples
# Creates a motif collection containing all motifs that occur in at least 20 sequences in the TFBS track
Collection1 = new Motif Collection(Track:TFBS, support >= 20)

# Creates a collection with all motifs that occur in more than 80% of the sequences in the TFBS track
Collection2 = new Motif Collection(Track:TFBS, support > 80%)



Module Collection

Module Collections are a specific subtype of the general Collection data type that can only contain Module objects. Module Collections are mainly used to limit the application of certain operations and analyses to subsets of modules, but they can also be used to import modules from a file or return results from a module discovery method.

All Module Collections will appear in the "Motifs" panel in MotifLab's GUI, provided that you have selected to display "Module Collections" using the drop-down menu in this panel. You can create new Module Collections by pressing the "+" button in this panel and then selecting "Module Collection" from the appearing menu, or you can go to the "Data" menu in the top menu bar and select "Add New ⇒ Module Collection".

Creating Module Collections

As described in the general section on collections, Module Collections can be created by explicitly listing the names of modules to include, using condititions to select modules based on property values or values in Numeric Maps, or importing module collections from files. In addition, Module Collections can also be based on sequence support in module tracks or be derived from interaction partner annotations in motif objects.
Collections based on module occurrences
Module collections can be based on modules that have a certain sequence support in a module track. By sequence support for a module we mean the number of sequences that contain at least one occurrence of that particular module. For example, one could create a collection with modules that occur in at least 20 sequences or in 80% of all sequences.
In the GUI you can create such collections by selecting "Add New ⇒ Module Collection" from the "Data" menu and then go to the "From Track" tab. First select the module track from the drop-drop down menu at the top, then select the comparator function (=,<,<=,>,>=,<>,in) and target value from the bottom menus. The target value can be an absolute number or a relative percentage number (in which case the value should be between 0 and 100), and the value can either be a literal number or a numeric data object (Numeric Variable or Module Numeric Map).
The general syntax for creating such module collections in protocols is the following:

MyCollection = new Module Collection(Track: <region track>, support <comparator> <target value>)

Examples
# Creates a module collection containing all modules that occur in at least 20 sequences in the Mod1 track
Collection1 = new Module Collection(Track:Mod1, support >= 20)

# Creates a collection with all modules that occur in more than 80% of the sequences in the Mod2 track
Collection2 = new Module Collection(Track:Mod2, support > 80%)

Collections based on known TF interactions
Motifs can be annotated with lists of known interaction partners (i.e. other motifs) for the associated TF, which give rise to networks of motifs for interacting factors. This information can be used to derive modules based on TFs with known interactions. For a pair of motifs, A and B, it is sufficient that one of the motifs has an annotated interaction with the other for MotifLab to regard the two motifs as interacting (i.e. a one-way directional connection is regarded as being equal to a bidirectional connection). In the GUI you can create such collections by selecting "Add New ⇒ Module Collection" from the "Data" menu and then go to the "From Interactions" tab to specify a set of arguments controlling how the collection should be created. Note that this process will not only create a module collection object, but also create all the underlying modules in that collection. All the created modules will be unordered.

1) Defining module motifs
The first step in the module creation process is to define the potential module motifs (or meta motifs) that can form the constituent motifs of the modules. This is controlled by the "Group" argument, which can optionally specify a Motif Partition with clusters of motifs that should be considered equivalent to each other (e.g. because they represent the same transcription factor). A module motif (either single motif of cluster) is considered to be interacting with another module motif if at least one of the basic motifs in one of the module motifs are interacting with one of the basic motifs in the other module motif.
If the "Group" argument is left blank, each module motif will correspond directly to a single basic motif. However, if the motifs are grouped with a Motif Partition, each potential module motif will correspond to a cluster of motifs. If the "Group" argument is not used, it is possible to use the "Motifs" argument to specify a smaller collection of motifs to consider for this step. If both "Group" and "Motifs" are defined, the "Group" argument will take precendence and the "Motifs" argument will be ignored.

2) Selecting module configurations
The "Configurations" argument controls how MotifLab should search the motif interactions network to discover modules. To avoid generating an enormous number of modules from transitive interactions, only cliques in the interaction network will be considered. The cliques can be of size 2 or larger.
  • Pairwise: The modules will be based on pairs of interacting motifs
  • Maximal clique: A maximal clique is a subset of the nodes in the network where every node is connected to every other node in this subset, and the subset cannot be expanded with additional nodes without violating the clique property (i.e. there are no other nodes in the whole network that are connected to all of the nodes in the subset). The figure below shows a network with four maximal cliques highlighted in different colors.
  • Maximum clique: A maximum clique is a maximal clique which also has the largest number of nodes in the whole network. There can be several maximum cliques but they must then all have the same size (and no other maximal clique can be bigger). In the figure below, the red maximal clique on the left is also a maximum clique.


3) Limiting module cardinality
If you have selected the "Pairwise" module configuration, all the created modules will have cardinality equal to 2. However, if you have selected the "maximal" or "maximum clique" configurations, the cardinality of the returned modules can be constrained with the "Cardinality limit" option. If this is set to either "at least", "at most" or "exactly", the "Cardinality" argument can specify a number to compare against to constrain the set of returned modules. For example, if "Cardinality limit" is set to "at least" and "Cardinality" to "3", only modules of cardinality 3 or higher will be created.

4) Self-interacting motifs
Some transcription factors can interact with other factors of the same type (homo-dimers), so a motif is also allowed to interact with itself. If the "Include self-interactions" option is selected, MotifLab may potentially create modules that consist of pairs of motifs of the same type, e.g. "M1–M1". However, larger modules than that are not allowed to contain duplicate motifs, so if motif "M1" interacts with itself as well as "M2", the modules "M1–M1" and "M1–M2" may be created but not "M1–M1–M1" and "M1–M1–M2". The algorithm that searches for maximal cliques considers cliques that only contain self-interacting motifs to be of size 1, so if M1 interacts with itself as well as M2 and the "maximum clique" configuration is selected, only the "M1–M2" clique will be returned (since this has cardinality 2 whereas "M1–M1" is considered to be of cardinality 1, which is not maximum). However, the "maximal clique" configuration will return both modules.

5) Limiting module span
The "Width limit" argument can be used to specify an optional size limit on the module (in bp). If "Width limit" is set to "Total width", the value of the associated "Width" argument defines the maximum length of the module. If "Width limit" is set to "Width per motif", then the width property of each module will be set to the value of the "width" argument multiplied by the cardinality of the module. If "Width limit" is set to "No limit", then no width propery is set. For example, if module M1 consists of 2 component motifs and module M2 of 3 component motifs, then if "Width" is set to 200 (bp) and "Width limit" to "Total width", the width limit of both of these modules is set to 200bp. However, if instead "Width limit" is set to "Width per motif", the width limit of module M1 is set to 200x2=400bp, whereas the width limit of module M2 is set to 200x3=600bp.

6) Limiting collection size
If the number of edges in the motif interaction network is large, the number of modules that will be created can potentially be huge. It is possible to limit the size of the returned collection with the "Collection limit" argument. If this is set to a value greater than zero, at most that many modules will be created. The modules are not prioritized in any particular order. In the GUI you can see how many modules MotifLab will create from the motif interactions network with the current argument settings by pressing the "How many modules will be created?" button at the bottom of the dialog. If you consider the number of modules to be too large, you can either set the "Collection limit" to an explicit number or try to limit the number of modules by tweaking the other arguments.

The general syntax for creating module collections from interactions in protocols is the following:

MyModules = new Module Collection(Interactions: < ... list of arguments ... >)

Examples
# Creates a module collection with modules based on pairs of interacting motifs.
# Each module will have its global "Max span" constraint set to the cardinality of the module times 50bp
Collection1 = new Module Collection(Interactions:Configurations="Pairwise", Width limit="Width per motif",Width=50)

# Creates a module collection with modules based on cliques of interacting motifs of size 4 or greater
Collection2 = new Module Collection(Interactions:Configurations="Maximal cliques",
                                    Cardinality limit="At least",Cardinality=4)



Partition

A partition can be thought of as a kind of "super collection" or "collection of collections", or more specifically: a partitioning of data objects into non-overlapping groups called clusters. Partitions are used to refer simultaneously to multiple non-overlapping subsets/clusters of existing data objects. Partitions usually always refer to clusterings of data objects of one the three basic data types (motif, module and sequence), and specific subtypes of partitions exist for these types called respectively Motif Partition, Module Partition and Sequence Partition. Although rarely needed, Text Variables can be used to specify more general partitions that are not limited to contain data objects of the basic types. Partitions can, to some extent, be considered as a special case of the Text Map data type, but as Text Maps were only introduced in version 2 of MotifLab, the Partition type predates the more general Text Map.

Creating Partitions

Partitions can be created manually by explicitly listing which data objects to include in which clusters of the Partition, or by clustering data objects automatically based on certain inclusion criteria. Partitions can also be based on or extracted from some other data objects, typically Collections, Maps and Analyses. For additional ways to create Motif Partitions, Module Partitions and Sequence Partitions, refer to their respective sections.
Manual clustering
From the Partitions' GUI dialogs you can select which entries to include in which clusters by going to the "Manual Entry" tab. Here you can click on entries in the table to select them, and you can hold down the SHIFT and CONTROL keys to select contiguous and non-contiguous ranges respectively. Right-clicking on the table will bring up a context-menu with more options to select items based on different collections. When you have selected a set of entries, right-click on the table to bring up the context menu where you can choose to add the selected entries to an existing cluster or to a new cluster that you will have to name in a popup dialog. Cluster names are case-sensitive and can only contain letters, numbers and underscores (no spaces or special characters). You can also choose to remove the selected entries from their currently assigned clusters. The name of the cluster that each item is assigned to is shown in the second column, and items that have not been associated with a cluster are marked as "unassigned".

The "From List" tab lets you to type in comma-separated lists of items to include in each cluster on the format: "<item list> = <cluster name>", and it also allows for the use of wildcards and range operators. For example, the star wildcard operator (*) stands for "any string of letters or numbers" so if you enter "MA01* = <clustername>" the cluster will include all data items whose names begin with "MA01" (of the relevant type). Many motifs and sequences have names/identifiers on a specific format containing some letters and an incremental number. The colon range operator allows you to specify a subset of items based on a numeric range within the identifier. For example, the range "MA0100b:MA0200b" will include all items whose names start with "MA", ends with "b" and have a number in the middle between 100 and 200 (the prefixes and suffixes around the number are optional but must be the same for all the items, and the numbers need not have the same number of digits). When listing items, the names can refer to either a single basic data object (motif,module,sequence), a Collection, or a cluster within another Partition (using the notation "PartitionName->ClusterName"). Note that the "From List" tab allows cluster entries to be separated by either semicolons or newlines, but in a protocol script they must be separated by semicolons (they will be converted automatically in "record mode").

It is possible to assign items to the same cluster in separate assignments by reusing the cluster name on the right-hand side of the equals sign. For example, the assignments "MA0005 = Upregulated; MA0006 = Upregulated" will assign both MA0005 and MA0006 to the "Upregulated" cluster. However, each item can only belong to one cluster and it is the last assignment that applies, so the assignments "MA0005 = Upregulated; MA0005 = Downregulated" will assign MA0005 to the "Downregulated" cluster rather than "Upregulated".

If you use wildcards, range operators or refer to collections or clusters in the "From List" tab (i.e. refer to multiple data items with one entry), the list can either be parsed and resolved immediately or this can be delayed to when it is first needed ("resolved in protocol"). This can be controlled with a checkbox in the "From List" tab. If you choose to "resolve immediately" (by unchecking "resolve in protocol"), then immediately after you press the "OK" button to create the partition, MotifLab will go through all the listed entries to find out exactly which of the currently defined motifs, modules or sequences to include in each cluster of the partition. The resulting explicit list of basic data objects will then constitute the constructor string for the partition, which is a description of how the partition should be created. This constructor string will be included in the protocol (if you are currently in "record mode") and also as meta-data in the newly created partition itself. (By the way, you can see the constructor for a data object by selecting it in one of the data panels and pressing the "P" key. The constructor will be shown in the log panel.) If you rather choose to "resolve in protocol", the constructor string will instead be the exact text you entered in the "From List" tab (with newlines replaced with semicolons) prefixed by "List:". The consequence of "resolving immediately" will thus be that entries in the partition are fixed in the protocol even before it is executed, whereas with "resolve in protocol" the final clustering in the partition will be decided dynamically when the protocol is run based on the currently defined data objects and contents of other collections and partitions.

# Creates a Motif Partition where the motifs M00007 and M00013 are assigned to a cluster named "First",
# and M00014 and M00015 are assigned to a cluster named "Second". All remaining motifs will be "unassigned"
Partition1 = new Motif Partition(M00007, M00013 = First; M00014 = Second; M00015 = Second;)

# Creates a Motif Partition where all motifs from the UPREGULATED collection are assigned to the "up" cluster
# and all motifs from the DOWNREGULATED collection are assigned to the "down" cluster
Partition2 = new Motif Partition(UPREGULATED=up; DOWNREGULATED=down)

# Creates a new Motif Partition where all the motifs from the clusters named "Upregulated" and "Downregulated"
# within the existing partition named "Significant" are assigned to the "significant" cluster
# while all other motifs are assigned to the "nonsignificant" cluster
Partition3 = new Motif Partition(*=nonsignificant; Significant->Upregulated,Significant->Downregulated = significant)

# Creates a Sequence Partition where all sequences whose names begin with "ENSG" are assigned to the "Human" cluster
# and all sequences whose names begin with "ENSMUS" are assigned to the "Mouse" cluster
Partition4 = new Sequence Partition(ENSG* = Human, ENSMUS* = Mouse)

# Creates a Module Partition where the modules MOD0005, MOD0006, MOD0007 and MOD0008 are assigned to "lower"
# and the modules MOD0100, MOD0101, MOD0102 and MOD0103 are assigned to "upper"
Partition5 = new Module Partition(MOD0005:MOD0008=lower;MOD0100:MOD0103=upper;)
Partitions based on properties
Partitions can be created by clustering data objects according to the values of certain properties, but this functionality is currently quite limited compared to the same functionality for creating collections. At the moment, only a handful of properties are supported, and clusters can only be made from sequences or motifs having the same value for these properties. Other comparison operators are not supported.
For more information, see the corresponding sections under Motif Partitions and Sequence Partitions.
Partitions based on values in Maps
Partitions can be created by clustering data objects according to their values in Numeric Maps. In the GUI you can create such partitions by selecting "Add New ⇒ <type> Partition" from the "Data" menu and then go to the "From Map" tab.
The general syntax for creating such partitions in protocols is the following:

MyPartition = new <Type> Partition(Map: <map name> <comparator> <target value> : <cluster name>)

The "Map:" prefix is followed by one or more cluster assignment rules separated by semicolons. Each assignment rule consists of a map value range defined by a map name, comparator and target value (similar to how collections are created from maps), which is then followed by a colon and a name for the cluster. To define a cluster in the GUI, first select the name of the map variable from the topmost drop-down menu, and then a comparator function from the first drop-down menu behind "Map value". The available comparator functions are: = , <> , < , <= , > , >= , in.
Then enter the target value in the third drop-down menu (after the comparator). The target value should be a single numeric value which can be either a literal string or a numeric data object. If the comparator is "in" the target value should be two numeric values denoting respectively the minimum and maximum value in the range (inclusive). In the protocol the range values must be separated by a comma and enclosed in brackets.
Finally, enter the cluster name in the text field before pressing the "Add" button. The rule will be added to the large text box at the top of the dialog. To add another cluster, simply enter new values in the drop-down menus and cluster name field and press "Add" again. Note that the rules do not have to refer to the same map. To discard a cluster assignment rule, select it in the large text box and press the "Remove button".

# Creates a partition where motifs having values below 0 in the map Fold are assigned to the cluster "negative",
# motifs with value 0 are assigned to "zero" and those with values above 0 are assigned to "positive"
Partition1 = new Motif Partition(Map: Fold<0:negative; Fold=0:zero; Fold>0:positive; )

# Creates a partition where sequences having Rank values below 10 are assigned to "Top",
# those with values between 10 and 20 are assigned to "Middle" and those with values above 20 are assigned to "Bottom"
Partition2 = new Motif Partition(Map: Rank<10:Top; Rank in [10, 20]:Middle; Rank>20:Bottom; )

Modifying Partitions

Partitions (like collections) can only be created with the operations new and extract, and they cannot really be modified after creation. However, you can achieve the same effect by simply creating a new partition with the same name to replace the older one. In the GUI, you can edit a partition by either double-clicking on it or right-clicking and selecting "Edit ..." from the context menu to bring up the Partition dialog. (As mentioned, this will not actually modify the existing partition, but rather create a new one with the same name.)

Using Partitions

Partitions were originally introduced to support clustering operations, although no such operations currently exist in MotifLab. However, external clustering algorithms that return partitions can still be used with the execute operation. The only other operation that returns a Partition is split_sequences, which creates new sequences based on regions in an input region track and returns a SequencePartition where each new sequence created is assigned to a cluster named after the sequence it originated from. Partitions can also be extracted from some other data objects. E.g., the compare motif occurrences analysis groups motifs into clusters based on whether or not they are overrepresented in one of two sequence sets, and these clusters can be extracted as a Motif Partition.

Partitions can also be used as arguments to some operations and analyses, typically to apply the operation/analysis to several individual groups in order. For example, the analyses GC-content, Numeric Map distribution, region dataset coverage and benchmark all calculate statistics on various data. By using a partition to group the data into clusters, these statistics will be calculated separately for each cluster. The prune operation can remove overlapping TFBS predictions that represent the same binding motif, and it relies on a Motif Partition to tell it which motifs are considered to be similar.

# Cluster sequences based on sequence similarity using the Starcode program
SequenceGroups = execute Starcode {Sequence Collection=AllSequences, ... }

# Extract a Motif Partition with 6 clusters from a Compare Motif Occurrences analysis that compares the frequency of
# motif occurrences in two sequence sets. The clusters contain:
# 1) the motifs that only occur in the first sequence set
# 2) the motifs that occur in both sets but are overrepresented the first set
# 3) the motifs that only occur in the second sequence set
# 4) the motifs that occur in both sets but are overrepresented in the second set
# 5) the motifs that occur with about the same frequency in both sequence sets (overrepresented in neither)
# 6) the motifs that do not occur at all in either of the sequence sets
Motif_groups = extract "clusters" from Analysis1_UP_vs_DOWN as Motif Partition

# Calculate GC-content statistics of a DNA track for each of the clusters in SequencePartition1
GC_analysis = analyze GC-content {DNA track=DNA, Groups=SequencePartition1}

# Finds overlapping regions in the TFBS track for motifs that are in the same cluster in the Motif Partition named
# 'AlternativePartition' and removes all the duplicates so that only the region with the highest score remains
TFBSpruned = prune TFBS remove "alternatives" from AlternativePartition keep "top scoring"



Sequence Partition

Sequence Partitions are a specific subtype of the general Partition data type that can only contain Sequence objects.

All Sequence Partitions will appear in the "Data Objects" panel in MotifLab's GUI. You can create new Sequence Partitions by pressing the "+" button in this panel and then selecting "Sequence Partitions" from the appearing menu, or you can go to the "Data" menu in the top menu bar and select "Add New ⇒ Sequence Partition".

Creating Sequence Partitions

As described in the general section on partitions, Sequence Partitions can be created by explicitly listing the names of sequences to include in each cluster, or by using assignment rules to select which sequences to include in each cluster based on their values in Numeric Maps. In addition, Sequence Partitions can also be based on the values of some sequence properties as described below.
Partitions based on sequence properties
Sequence Partitions can be created by clustering together sequences that have the same value for a selected sequence property.
Currently, only four such sequence properties are supported:
  • organism: Cluster together sequences originating from the same organism.
  • genome build: Cluster together sequences originating from the same genome build.
  • chromosome: Cluster together sequences from the same chromosome.
  • strand orientation: Divides the sequences into two clusters named "direct" and "reverse" based on each sequence's orientation.
    If the orientation of a sequence is not specified, it will be assigned to a third cluster named "undetermined".

In the GUI you can create such partitions by selecting "Add New ⇒ Sequence Partitions" from the "Data" menu and then go to the "From Property" tab and select the property from the drop-down menu. The general syntax for creating sequence partitions based on properties in protocols is the following:

MyPartition = new Sequence Partition(Property: <property name>)

Examples
# Cluster all the sequences based on genome build
Partition1 = new Sequence Partition(Property: genome build)

# Divide the sequences into two groups based on strand orientation
Partition2 = new Sequence Partition(Property: strand orientation)



Motif Partition

Motif Partitions are a specific subtype of the general Partition data type that can only contain Motif objects.

All Motif Partitions will appear in the "Motifs" panel in MotifLab's GUI, provided that you have selected to display "Motif Partitions" using the drop-down menu in this panel. The Partitions are displayed in a hierarchical fashion with three levels. The top level shows the partitions themselves, the second level shows the clusters and the third level shows the motifs within each cluster. You can create new Motif Partitions by pressing the "+" button in the motifs panel and then selecting "Motif Partitions" from the appearing menu, or you can go to the "Data" menu in the top menu bar and select "Add New ⇒ Motif Partition".

Creating Motif Partitions

As described in the general section on partitions, Motif Partitions can be created by explicitly listing the names of motifs to include in each cluster, or by using assignment rules to select which motifs to include in each cluster based on their values in Numeric Maps. In addition, Motif Partitions can also be based on the values of some motif properties as described below.
Partitions based on motif properties
Motif Partitions can be created by clustering together motifs that have the same value for a selected motif property.
Currently, only two such motif properties are supported:
  • Alternatives: Cluster together motifs that are annotated as alternatives for each other.
  • Class_X_levels: Cluster together motifs that have the same TRANSFAC classification, up to X levels.
    For example, level 1 will divide motifs into (1) basic domains, (2) zinc-coordinating, (3) Helix-turn-helix, (4) Beta-scaffold factors with minor groove contacts and (0) others, in addition to unknowns. Level 2 will further divide the basic domains factors in cluster 1 into e.g bZIP factors, basic HLH factors or bHLH-ZIP factors.

In the GUI you can create such partitions by selecting "Add New ⇒ Motif Partitions" from the "Data" menu and then go to the "From Property" tab and select the property from the drop-down menu. The general syntax for creating motif partitions based on properties in protocols is the following:

MyPartition = new Motif Partition(Property: <property name>)

Examples
# Cluster motifs into equivalence groups based on their alternatives annotations.
# Each cluster will be named after the motif with the shortest name.
Partition1 = new Motif Partition(Property: Alternatives)

# Cluster motifs into 6 groups based on their top-level TRANSFAC classification
Partition2 = new Motif Partition(Property: Class_1_level)

# Cluster motifs into groups based on the two topmost levels of the TRANSFAC classification hierarchy
Partition2 = new Motif Partition(Property: Class_2_levels)



Module Partition

Module Partitions are a specific subtype of the general Partition data type that can only contain Module objects.

All Module Partitions will appear in the "Motifs" panel in MotifLab's GUI, provided that you have selected to display "Module Partitions" using the drop-down menu in this panel. The Partitions are displayed in a hierarchical fashion with three levels. The top level shows the partitions themselves, the second level shows the clusters and the third level shows the modules within each cluster. You can create new Module Partitions by pressing the "+" button in the motifs panel and then selecting "Module Partitions" from the appearing menu, or you can go to the "Data" menu in the top menu bar and select "Add New ⇒ Module Partition".



Map

A map is basically a two-column lookup table which associates the name of a data object (or key in the first column) with a corresponding value (in the second column). There are two general types of maps: Numeric Maps and Text Maps. Numeric maps associate each data object with a numeric value, whereas values in Text Maps (introduced in MotifLab version 2) can be any text string. The general Numeric Map type have three specific subtypes – Sequence Numeric Map, Motif Numeric Map and Module Numeric Map – that hold values for sequences, motifs and modules, respectively. Likewise, the general Text Map type have the subtypes Sequence Map, Motif Map and Module Map. Other types of maps can be represented with the Text Variable type.

An example of a Motif Numeric Map that associates motif names with numeric values is shown below.

KeyValue
MA0001123
MA000264
MA000375
MA000418
MA00050
MA000696
MA00070
......
_DEFAULT_0

A data item, such as a motif, that is explicitly included in the map is said to have an assigned value, whereas data items that are not explicitly included in the map are unassigned and will use a default value instead. If you examine a map in the GUI, both assigned and unassigned entries will be shown in the table, but the values of unassigned entries that use the default value will be shown in a gray color rather than a black. Using the map shown above as an example, the MA0005 motif is unassigned, and its value, which defaults to 0, is therefore colored gray in the table. The value for the MA0007 motif is also 0, but this is not the default value since MA0007 is explicitly assigned as indicated by the black color used for the value. If the default value were to be changed to e.g. 3 at a later time, the value of MA0005 would then be 3, but the value of MA0007 would still be 0. Unless otherwise specified, the default value for Numeric Maps will be 0 and the default value for Text Maps will be an empty string.

Creating Maps

Maps can be created in the GUI by selecting "Add New ⇒ <Type> Map" from the "Data" menu, or by pressing the "+" button in the Data Objects panel menu and selecting the map type from the drop-down menu. All maps of every type will appear in the Data Objects panel.

The general syntax for creating maps in protocols is shown below. The values for different data items are specified with a comma-separated list of "key=value" pairs.

MyMap = new <Type> Map(<key1>=<value1>, <key2>=<value2>, ... , <keyN>=<valueN>, _DEFAULT_=<value>)

The key can refer to a collection, in which case all the entries in the collection will be associated with that value. The key can also contain the wildcard symbol (*) that will match any string of characters. In MotifLab v2, keys can refer to clusters within partitions on the form "PartitionName->cluster", and the range operator is also supported (see documentation for Collections). All the items that are included in the list will have assigned values, and all the rest will have unassigned values and therefore use the default value which is specified with the "_DEFAULT_" key. (The default value can also be specified by simply dropping the key in the key-value pair and just stating the value.)

Examples
# Create an "empty" Motif Numeric Map with default value 7.
# All motifs will be unassigned and fall back to the default value.
MotifNumericMap1 = new Motif Numeric Map(7)

# Create a Motif Numeric Map with default value 0 (implicit) and three motifs with explicitly assigned values.
MotifNumericMap2 = new Motif Numeric Map(MA00001=243, MA00002=132, MA00003=193)

# Create a Motif Numeric Map where each motif is assigned the value 8. The default value will be 0 (implicit).
MotifNumericMap3 = new Motif Numeric Map(*=8)

# Create a Sequence Numeric Map where all sequences whose names start with ENSG have value 1
# and those whose names start with ENSMUS have value -1. Other sequences have the default value (0)
SequenceNumericMap1 = new Sequence Numeric Map(ENSG*=1, ENSMUS*=-1)

# Create a Motif Numeric Map where all motifs in the TRANSFAC collection have value 1
# and all motifs in the JASPAR collection have value 2
MotifNumericMap4 = new Motif Numeric Map(TRANSFAC=1, JASPAR=2)

# Create a Module Text Map where all modules in the "C1" cluster in ModPar1 have values "hello world"
# and those in the "C2" cluster have values "goodbye world"
ModuleMap1 = new Module Map(ModPar1->C1="hello world", ModPar1->C2="goodbye world")

# Create a Motif Text Map where all motifs in the range MM0001-MM0199 have the value "first"
# and those in the range MM0200-M0299 have the value "second"
MotifMap1 = new Module Map(MM0001:MM0199="first", MM0200:MM0299="second")

Modifying Maps

Values in maps can be set explicitly with the set operation or changed relative to the current values with the arithmetic operations increase, decrease, multiply and divide. Numeric Maps can also be transformed with threshold and transform.

When an operation is applied to a whole map, the default value will also be changed accordingly. However, if you only apply the operation to a subset of the entries in the map, the default will not be changed. It is currently not possible to directly change the value of a single named entry in the map. This can only be done by first creating a collection containing only that data item and then limiting the application of a map operation to elements in that collection. Also, the default value of a map cannot be changed directly by itself, but this limitation can also be circumvented with the more cumbersome approach shown in the last example below.

Note:
When a modifying operation is applied to a map, MotifLab will go through all the applicable entries and recalculate the values before updating each of these entries in the map. This will mean that entries that were previously unassigned may now suddenly become assigned. It you want to avoid this, you will have to limit the operation to only apply to the currently assigned entries as shown in the example below. Likewise, if you output a full map to a file and then import it back again later, entries that were unassigned in the original map will be assigned in the new map. To avoid this you should only output the assigned entries to the file (plus the default value).

Examples
# Increase the values of all entries in the map by 3, including the default value.
# Note: Previously unassigned entries in the map will now become assigned.
increase MotifNumericMap2 by 3

# Increase the values of all assigned entries in the map by 3. (The default is not changed)
# This is done by first creating (extracting) a collection with all currently assigned entries
# and then limiting the application of the operation to only the entries in this collection.
AssignedEntries = extract "assigned entries" from MotifNumericMap2 as Motif Collection
increase MotifNumericMap2 by 3 in collection AssignedEntries

# Increase the values of all entries in the map by their corresponding values in a second map
increase MotifNumericMap1 by MotifNumericMap2

# Set the default value of the existing map MotifNumericMap2 to 13.
# This is accomplished by creating a backup copy of the original map, replacing the original with a new empty map
# with the new default value and finally resetting all the entries to their original values from the backup copy.
AssignedEntries = extract "assigned entries" from MotifNumericMap2 as Motif Collection
backup_copy = copy MotifNumericMap2
MotifNumericMap2 = new Motif Numeric Map(13)
set MotifNumericMap2 to backup_copy in collection AssignedEntries

Using Maps

Maps can be used to store information about e.g. the gene expression levels of you sequences (using a Sequence Numeric Map) or motif match score cutoff thresholds for individual motifs (using a Motif Numeric Map). Some operations, like statistic, will return maps, and the results of many analyses include tables whose individual columns can be extracted as maps. Maps can be used to hold additional information about basic data items (sequences, motifs and modules) similar to user-defined properties for these items. In fact, it is easy to extract a named property from a collection of such data items and return the result in a corresponding map. Likewise, it is just as easy to set (or modify) properties of basic data items to values held in maps.

# General syntax for extracting a property from a collection of basic data items and return the result as a Map
propertyMap = extract "<type>:"<property>" from SomeCollection as <Type of Map>

# Even simpler syntax for creating a map of a specified type based on some property
propertyMap = new <Type of Map>(Property:propertyname)

# Create a Motif Numeric Map containing the IC-content for each TRANSFAC motif
motif_IC = extract "motif:IC-content" from TRANSFAC as Motif Numeric Map
# Create a Motif Numeric Map with IC-contents for all known motifs
motif_IC = new Motif Numeric Map(Property:IC-content)

# Create a Sequence Map containing associated gene name for each sequence (if known)
geneNames = extract "sequence:gene name" from AllSequences as Sequence Map
# Same as above
geneNames = new Sequence Map(Property:gene name)

# General syntax to set properties of basic data items based on maps. The two alternatives achieve the same result.
# Note that not all properties are allowed to be altered in this way (e.g. size properties are usually derived)
set SomeCollection[propertyname] to SomeMap
set SomeCollection property "propertyname" to SomeMap

# Add a user-defined numeric property called "score_cutoff" to all TRANSFAC motifs
set TRANSFAC[score_cutoff] to MotifNumericMap1

# Increase the "score_cutoff" property of all TRANSFAC motifs by their corresponding value in MotifNumericMap2
increase TRANSFAC property "score_cutoff" by MotifNumericMap2
Using Maps as arguments
When you use a map as an argument for operations that handle collections of data objects, the argument will be behave in an intuitive way by taking on the value for the closest naturally associated object in each iteration. For example, if you use a Motif Numeric Map as a "cutoff threshold" argument in a motifScanning operation, the scanning algorithm will use the cutoff value associated with motif X in the map when scanning for hits to motif X, and the value for motif Y from the map will be used as cutoff when scanning for hits to motif Y. On the other hand, if you instead use a Sequence Numeric Map for the same cutoff argument, the value for sequence A in the map will be used as the cutoff when scanning for both motif X and Y in sequence A, but the value for sequence B from the map will be used for all motifs when scanning sequence B. For more information, see here!



Numeric Maps

A numeric map is a subtype of the general Map type where the values can only be numeric. There are three different types of numeric maps – Sequence Numeric Map, Motif Numeric Map and Module Numeric Map – that hold values for sequences, motifs and modules, respectively. Numeric maps that contain "Data⇔Value" associations for other types of data can be defined using Text Variables.

Creating Numeric Maps

The general syntax for creating Numeric Maps in a protocol is shown below.
MyNumericMap = new <Type> Numeric Map(<key1>=<value1>, <key2>=<value2>, ..., <keyN>=<valueN>, _DEFAULT_=<value>)

The argument is a comma-separated list of "key=value" pairs where the keys can be the name of a single data object (of the applicable type) or a collection. The wildcard operator (*) is also supported. In MotifLab v2, the key can also be a reference to a partition cluster, or it can refer to a range of data objects. The values on the right-hand side of the assignments can only be numeric constants and not references to other data objects (such as Numeric Variables).

Creating Random Numeric Maps
Sometimes it may be desirable to create maps containing a random value for each data item. This can be accomplished by first creating a map and then using the "random" transform operation to assign a random number to each entry. Note, however, that the transformation will only be applied to assigned entries in the map (plus the default value), so for this to work properly, all the entries in the original map must be assigned.

Incorrect way to create random maps
# Create an empty map with default value 0. Note that this map will NOT contain any assigned entries!
MyRandomMap = new Motif Numeric Map(0)
# Apply the random transform operation to change the map values to random numbers between 0 and 10.
# However, since the map does not contain any assigned entries, only the default value will be changed
# and all motifs will thus default to this same number (randomly chosen between 0 and 10)
transform MyRandomMap with random(10)

Correct way to create random maps
# Create an empty map where all motifs as explicitly assigned the value 0 using the wildcard operator
MyRandomMap = new Motif Numeric Map(*=0)
# Apply the random transform operation to change the map values to random numbers between 0 and 10.
# Since all entries were previously assigned, each entry is individually transformed into a new random number.
transform MyRandomMap with random(10)

Modifying Numeric Maps

Values in numeric maps can be set explicitly with the set operation or changed relative to the current values with the arithmetic operations increase, decrease, multiply and divide. Numeric Maps can also be transformed with threshold and transform.

# Increase the value of each map entry in Cutoff by 0.1 (including the default value)
increase cutoff by 0.1
# Multiply the value of each map entry in Map1 by its corresponding value in Map2
multiply Map1 by Map2



Sequence Numeric Map

A Sequence Numeric Map is a data object that associates sequences with numeric values. It is a subtype of Numeric Map which again is a subtype of Map.

Creating Sequence Numeric Maps

Sequence Numeric Maps can be created by explicitly assigning values to named sequences, sequence collections, sequence partition clusters or sequence ranges. (See documentation under Maps and Numeric Maps). In addition, Sequence Numeric Maps can be created based on numeric properties of sequences or on statistics from feature datasets as described below.
Creating Sequence Numeric Maps based on sequence properties
In the GUI you can create such maps by selecting "Add New ⇒ Sequence Numeric Map" from the "Data" menu and then go to the "From Property" tab and select the property from the drop-down menu. All numeric properties can be selected, both standard and user-defined.

The general syntax for creating Sequence Numeric Maps based on properties in protocols is the following:
SequenceNumericPropertyMap = new Sequence Numeric Map(Property: <propertyName> )

Examples
# Create a numeric map based on the size of each sequence
SequenceNumericMap1 = new Sequence Numeric Map(Property:length)

# Create a numeric map based on the user-defined sequence property "geneExpression"
SequenceNumericMap2 = new Sequence Numeric Map(Property:geneExpression)

Creating Sequence Numeric Maps based on feature track statistics
In the GUI you can create such maps by selecting "Add New ⇒ Sequence Numeric Map" from the "Data" menu and then go to the "From Statistic" tab. Press the "Select" button to bring up a second popup dialog where you can define the statistic function by selecting the feature track, type of statistic function and any conditions that may limit the function. Press "OK" and "OK" again to create the map.

The general syntax for creating Sequence Numeric Maps based on feature track statistics in protocols is the following:
SequenceNumericPropertyMap = new Sequence Numeric Map(Statistic: <statistic function> )

Examples
# Create a numeric map based on the GC-content of each sequence
SequenceNumericMap1 = new Sequence Numeric Map(Statistic:"GC-content" in DNA)

# Create a numeric map based on the number of TFBS regions in each sequence
SequenceNumericMap2 = new Sequence Numeric Map(Statistic:"region count" in TFBS)

# Create a numeric map based on average conservation score of each sequence
SequenceNumericMap3 = new Sequence Numeric Map(Statistic:"average value" in Conservation)



Motif Numeric Map

A Motif Numeric Map is a data object that associates motifs with numeric values. It is a subtype of Numeric Map which again is a subtype of Map.

Creating Motif Numeric Maps

Motif Numeric Maps can be created by explicitly assigning values to named motifs, motif collections, motif partition clusters or motif ranges. (See documentation under Maps and Numeric Maps). In addition, Motif Numeric Maps can be created based on numeric properties of motifs or on motif occurrences in a motif track as described below.
Creating Motif Numeric Maps based on motif properties
In the GUI you can create such maps by selecting "Add New ⇒ Motif Numeric Map" from the "Data" menu and then go to the "From Property" tab and select the property from the drop-down menu. All numeric properties can be selected, both standard and user-defined.

The general syntax for creating Motif Numeric Maps based on properties in protocols is the following:
MotifNumericPropertyMap = new Motif Numeric Map(Property: <propertyName> )

Examples
# Create a numeric map based on the size of each motif
MotifNumericMap1 = new Motif Numeric Map(Property:Size)

# Create a numeric map based on the information content of each motif
MotifNumericMap2 = new Motif Numeric Map(Property:IC-length)

Creating Motif Numeric Maps based on motif occurrences
In the GUI you can create such maps by selecting "Add New ⇒ Motif Numeric Map" from the "Data" menu and then go to the "From Track" tab. Select the motif track in the top-most drop-down menu and the statistical function from the "Property" menu. Available statistical functions are:
  • Total count : returns the total number of occurrences for each motif in all sequences
  • Sequence support : returns the number of sequences each motif occurs in
  • Frequency : returns the motif frequencies (total occurrences of each motif divided by the theoretical maximum number of occurrences)
  • Max occurrences : the theoretical maximum number of times each motif can occur in the sequences (used to calculate frequency)
The maximum number of potential motif occurrences used to calculate the frequency and max occurrences will depend on both the motif length and the sequence lengths. Hits on both strands are considered, so the frequency for each motif will be: M/(Σi 2*(Si-m+1)), where M is the total number of motif occurrences, m is the motif length and Si is the sequence length of sequence i. If you want, you can limit the calculations to a subset of the sequences and optionally also only include motifs that lie fully within regions in a second track.

The general syntax for creating Motif Numeric Maps based on motif occurrences in a motif track is the following:
MotifOccurrencesMap = new Motif Numeric Map(Track:<motif track name>, property=<statistical function>                                              , Sequence Collection=<subset>, within=<region dataset> )

Examples
# Create a numeric map based on the total number of occurrences of each motif in the TFBS track
MotifOccurrences = new Motif Numeric Map(Track:TFBS, property=Total count)

# Create a numeric map based on the number of sequences that contain an occurrence of the motif within a repeat region
MotifOccurrences = new Motif Numeric Map(Track:TFBS, property=Sequence support, within=RepeatMasker)

# Create a numeric map with the frequency of each motif within sequences in the Downregulated collection
MotifOccurrences = new Motif Numeric Map(Track:TFBS, property=Frequency, Sequence Collection=Downregulated)



Module Numeric Map

A Module Numeric Map is a data object that associates modules with numeric values. It is a subtype of Numeric Map which again is a subtype of Map.

Creating Module Numeric Maps

Module Numeric Maps can be created by explicitly assigning values to named modules, module collections, module partition clusters or module ranges. (See documentation under Maps and Numeric Maps). In addition, Module Numeric Maps can be created based on numeric properties of modules or on module occurrences in a module track as described below.
Creating Module Numeric Maps based on module properties
In the GUI you can create such maps by selecting "Add New ⇒ Module Numeric Map" from the "Data" menu and then go to the "From Property" tab and select the property from the drop-down menu. All numeric properties can be selected, both standard and user-defined.

The general syntax for creating Module Numeric Maps based on properties in protocols is the following:
ModuleNumericPropertyMap = new Module Numeric Map(Property: <propertyName> )

Examples
# Create a numeric map based on the number of component motifs in each module
ModuleNumericMap1 = new Module Numeric Map(Property:Cardinality)

# Create a numeric map based on the sum of the IC-contents for the motif models
# having the highest IC for each component motif
ModuleNumericMap2 = new Module Numeric Map(Property:Max IC)

Creating Module Numeric Maps based on module occurrences
In the GUI you can create such maps by selecting "Add New ⇒ Module Numeric Map" from the "Data" menu and then go to the "From Track" tab. Select the module track in the top-most drop-down menu and the statistical function from the "Property" menu. Available statistical functions are:
  • Total count : returns the total number of occurrences for each module in all sequences
  • Sequence support : returns the number of sequences each module occurs in
If you want, you can limit the calculations to a subset of the sequences and optionally also only include modules that lie fully within regions in a second track.

The general syntax for creating Module Numeric Maps based on module occurrences in a module track is the following:
ModuleOccurrencesMap = new Module Numeric Map(Track:<module track name>, property=<statistical function>                                              , Sequence Collection=<subset>, within=<region dataset> )

Examples
# Create a numeric map based on the total number of occurrences of each module in the CRM track
ModuleOccurrences = new Module Numeric Map(Track:CRM, property=Total count)

# Create a numeric map based on the number of sequences that contain an occurrence of the module within a repeat region
ModuleOccurrences = new Module Numeric Map(Track:CRM, property=Sequence support, within=RepeatMasker)



Text Maps

A text map is a subtype of the general Map type where the values associated with each data item are text strings. There are three different types of text maps – Sequence Map, Motif Map and Module Map – that hold values for sequences, motifs and modules, respectively. (Note that the names of these types do not include "Text Map" just "Map"). Text maps that contain "Data⇔Value" associations for other types of data can be defined using Text Variables.

Creating Text Maps

The general syntax for creating Text Maps in a protocol is shown below.
MyTextMap = new <Type> Map(<key1>=<value1>, <key2>=<value2>, ..., <keyN>=<valueN>, _DEFAULT_=<value>)

The argument is a comma-separated list of "key=value" pairs where the keys can be the name of a single data object (of the applicable type) or a collection. The wildcard operator (*) is also supported. In MotifLab v2, the key can also be a reference to a partition cluster, or it can refer to a range of data objects. The value on the right-hand side of an assignment can be any text string but may in some cases require special formatting. If you want the value of a key-value pair itself to contains commas, the whole value must be enclosed in double quotes so that these commas can be discerned from the other commas separating the key-value pairs. Double quotes can optionally be used around all values, even those that do not contain commas. A value can contain internal quotes as long as these are properly opened and closed. If you want to include double quotes inside a value that is already surrounded by quotes, the internal quotes must be escaped with a backslash-prefix, like so: \"
Examples
Consider the following Text Map that contains two entries with "complicated" values. The value for the second entry contains a comma, whereas the third entry value contains quotes. The first set of examples below illustrate proper ways to create this map, while the second set of examples will not work.

KeyValue
MM0001E-box
MM0002Fos,Jun
MM0003A "CREB-like" motif

Correct ways to create the map above
# The value for the second entry is correctly enclosed with quotes. The third entry can actually be left as is.
MyTextMap = new Motif Map(MM0001=E-box, MM0002="Fos,Jun", MM0003=A "CREB-like" motif)

# Here, all the values are surrounded by quotes, but the internal quotes in the third value must then be escaped
MyTextMap = new Motif Map(MM0001="E-box", MM0002="Fos,Jun", MM0003="A \"CREB-like\" motif")

Incorrect ways to create the map above
# The value for the second entry is not enclosed in quotes, so MotifLab believes that the comma between Fos and Jun
# separates successive key-value pairs. This will lead to an error since "Jun" is not a properly formatted pair.
MyTextMap = new Motif Map(MM0001=E-box, MM0002=Fos,Jun, MM0003=A "CREB-like" motif)

# Here, all the values are surrounded by quotes, but the internal quotes in the third value causes problems
# since they are not properly escaped
MyTextMap = new Motif Map(MM0001="E-box", MM0002="Fos,Jun", MM0003="A "CREB-like" motif")

Modifying Text Maps

Values in text maps can be assigned explicitly with the set operation. Text Maps can also be changed relative to their current values with the arithmetic operations increase, decrease, multiply and divide, but note that these behave differently when applied to Text Maps compared to Numeric maps. The increase and multiply operations both behave like "set union" operators that will add new entries to a comma-separated value list (unless the list already contains the entries). Decrease and divide, on the other hand, behave like "set minus" operators that will remove entries from a comma-separated value list.

The threshold and transform operations are not supported for Text Maps.

Examples
# Create a few initial data objects
Map1 = new Motif Map(MM0001="A", MM0002="B", MM0003="C")
Map2 = new Motif Map(MM0001="X", MM0002="Y", MM0003="Z,W")
Col1 = new Motif Collection(MM0001,MM0002)
Text1 = new Text Variable("B")
Text2 = new Text Variable("A,R")

# Now start manipulating Map1 by adding the entry "R" to each map value
increase Map1 by "R"
# The values in Map1 are now: MM0001="A,R" and MM0002="B,R" and MM0003="C,R"

increase Map1 by Text1 in collection Col1
# The value of Text1, which is "B", is added to the map entries for MM0001 and MM0002 (as members of Col1)
# However, since the list-value for MM0002 already contains "B" it will not be added a second time.
# The values in Map1 are now: MM0001="A,R,B" and MM0002="B,R" and MM0003="C,R"

multiply Map1 by Map2
# "multiply" has the same effect as "increase" and will add the corresponding values from Map2 to the lists in Map1.
# The values in Map1 are now: MM0001="A,R,B,X" and MM0002="B,R,Y" and MM0003="C,R,Z,W"

decrease Map1 by "B"
# Decrease will remove entries from the lists
# The values in Map1 are now: MM0001="A,R,X" and MM0002="R,Y" and MM0003="C,R,Z,W"

decrease Map1 by "A,R"
# When a constant string value is used as argument, the value is interpreted as a single value rather than a list
# of individual values. Since none of the list-entries in the maps correspond directly to 'A,R', the map will not be
# changed and the values in Map1 are still: MM0001="A,R,X" and MM0002="R,Y" and MM0003="C,R,Z,W"
# Note that this also applies to increase. If you increase by "A,R" this will be added as a single value
# which just happens to include a comma. (In the GUI such values will be enclosed in brackets).

decrease Map1 by Text2
# However, if the argument is another data object rather than a string constant, it will be interpreted as a list.
# So in this case the two values "A" and "R" (defined by Text2) will be removed from the lists
# The values in Map1 are now: MM0001="B,X" and MM0002="B,Y" and MM0003="C,Z,W"

# Note that the operations will also be applied to the default value unless limited to a collection.
# Since the default value of Map1 was not specified, it started out as an empty string but was changed to "R"
# by the first increase operation. This value persisted until the "R" was removed by the last decrease operation here.



Sequence Map

A Sequence Map (also called Sequence Text Map) is a data object that associates sequences with textual values. It is a subtype of Text Map which again is a subtype of Map.

Creating Sequence Maps

Sequence Maps can be created by explicitly assigning values to named sequences, sequence collections, sequence partition clusters or sequence ranges. (See documentation under Maps and Text Maps). In addition, Sequence Maps can be created based on properties of sequences as described below.
Creating Sequence Maps based on sequence properties
In the GUI you can create such maps by selecting "Add New ⇒ Sequence Map" from the "Data" menu and then go to the "From Property" tab and select the property from the drop-down menu. All properties can be selected, both standard and user-defined, textual or numeric. (Note that numeric values will be converted to text strings in the map.)

The general syntax for creating Sequence Maps based on properties in protocols is the following:
SequencePropertyMap = new Sequence Map(Property: <propertyName> )

Examples
# Create a map based on the chromosome name of each sequence
SequenceMap1 = new Sequence Map(Property:chromosome)

# Create a map based on the user-defined sequence property "geneExpression"
SequenceMap2 = new Sequence Map(Property:geneExpression)



Motif Map

A Motif Map (also called Motif Text Map) is a data object that associates motifs with textual values. It is a subtype of Text Map which again is a subtype of Map.

Creating Motif Maps

Motif Maps can be created by explicitly assigning values to named motifs, motif collections, motif partition clusters or motif ranges. (See documentation under Maps and Text Maps). In addition, Motif Maps can be created based on properties of motifs as described below.
Creating Motif Maps based on motif properties
In the GUI you can create such maps by selecting "Add New ⇒ Motif Map" from the "Data" menu and then go to the "From Property" tab and select the property from the drop-down menu. All properties can be selected, both standard and user-defined, textual or numeric. (Note that numeric values will be converted to text strings in the map.)

The general syntax for creating Motif Maps based on properties in protocols is the following:
MotifPropertyMap = new Motif Map(Property: <propertyName> )

Examples
# Create a map based on the IUPAC consensus for each motif
MotifMap1 = new Motif Map(Property:Consensus)

# Create a map based on the names of TFs associated with each motif
MotifMap1 = new Motif Map(Property:Factors)



Module Map

A Module Map (also called Module Text Map) is a data object that associates modules with textual values. It is a subtype of Text Map which again is a subtype of Map.

Creating Module Maps

Module Maps can be created by explicitly assigning values to named modules, module collections, module partition clusters or module ranges. (See documentation under Maps and Text Maps). In addition, Module Maps can be created based on properties of modules as described below.
Creating Module Maps based on module properties
In the GUI you can create such maps by selecting "Add New ⇒ Module Map" from the "Data" menu and then go to the "From Property" tab and select the property from the drop-down menu. All properties can be selected, both standard and user-defined, textual or numeric. (Note that numeric values will be converted to text strings in the map.)

The general syntax for creating Module Maps based on properties in protocols is the following:
ModulePropertyMap = new Module Map(Property: <propertyName> )

Examples
# Create a map based on the names of the constituent motifs for each module
ModuleMap1 = new Module Map(Property:Motifs)



Numeric Variable

The Numeric Variable is the simplest data type in MotifLab and can only hold a single numeric value. New numeric variables can be created with the operation new (using either a literal number, a collection, or a numeric map as argument) or by extracting numeric values from analyses or other data objects. Numeric Variables can also be manipulated with arithmetic operations (increase, decrease, multiply and divide) and transform.

Creating Numeric Variables

# Create a new Numeric Variable with the specific value 3.14
NumericVar1 = new Numeric Variable(3.14)

# Create a new Numeric Variable based on the number of entries in the given collection
NumericVar2 = new Numeric Variable(SequenceCollection1)

# Create a new Numeric Variable based on the default value from the given Numeric Map
NumericVar3 = new Numeric Variable(NumericMap2)

# Create a new Numeric Variable by extracting the largest value from a given Numeric Map
NumericVar4 = extract "top value" from NumericMap2 as Numeric Variable

# Create a new Numeric Variable by extracting a specific result from an analysis
NumericVar5 = extract "p-value at least observed overlap" from Analysis1 as Numeric Variable

# Create a new Numeric Variable derived from the value of another Numeric Variable
NumericVar6 = multiply NumericVar1 by 10

Using Numeric Variables

Numeric Variables can be used to represent numeric values wherever they may appear, such as in arguments for other operations.
# Create a new Numeric Variable named "Cutoff" and use this as an argument in the subsequent
# filter operation to delete regions that have a score below this value
Cutoff = new Numeric Variable(90)
filter RegionDataset1 where region score < Cutoff



Text Variable

The Text Variable is one of the structurally simplest data types in MotifLab (second only to Numeric Variable), but since it can contain basically any form of textual information it is also one of the most versatile. It can often be used as a general substitute for other more complex types such as collections, partitions and maps. The data contained in a Text Variable is either a single text string or multiple lines of text, and depending on how the text is organized, Text Variables can be treated as either lists, sets, tables or documents (in some specific format or just free text).

Creating Text Variables

# Create a new Text Variable with a single line of text
TextVar1 = new Text Variable("a single line of text")

# Escape double quotes with \" and TABs with \t
TextVar2 = new Text Variable("first column\tsecond \"quote\" column")

# Multiple lines of text should be defined as a comma-separated list
TextVar3 = new Text Variable("the first line","the second line")

# Read contents from file
TextVar4 = new Text Variable(File:"dir/subdir/filename")

# Read contents from an Output Data object
TextVar5 = new Text Variable(Input:Output1)

Using Text Variables

Text variables can be used to hold information in free-text or structured formats, they can provide textual values for operation arguments or function as substitutes for general collections, partitions or maps. They can also serve as templates for configurable output formats such as Template, TemplateHTML and Properties.
# The Text Variable defines the name of a repeat region type and is used with the filter operation
# to remove only repeats of this type from the track
TextVariable1 = new Text Variable("Alu")
filter RepeatMasker where region's type equals TextVariable1

# Here the Text Variable represents a collection of repeat region types and will filter repeats of
# any of the three types: AluJo, MIR and L2
TextVariable2 = new Text Variable("AluJo","MIR","L2")
filter RepeatMasker where region's type is in TextVariable2

# The RepeatClass Text Variable below is formatted as a map containing "key=>value" pairs.
# When this map is used in conjunction with the replace operation on the RepeatMasker region dataset
# the type property of every region that matches a key in the map will be replaced by its corresponding
# value. The result here being that all "Alu" and "MIR" regions are renamed to "SINE" and all "L1" and "L2"
# regions are renamed to "LINE"
RepeatClass = new Text Variable("Alu=>SINE","MIR=>SINE","L1=>LINE","L2=>LINE")
replace RepeatClass with RepeatClass in RepeatMasker

# In addition to the regular TFBS track and collection of discovered motifs, the motif discovery method
# below returns an additional file with some extra information about the results. Since this information
# is not structured in any way that could be suitably represented by another data type,such as a Motif Map,
# the information is simply stored in free-text in a Text Variable object (here called "ExtraInfo").
[TFBS,Motifs,ExtraInfo] = motifDiscovery in DNA with MDmethod { ... }


# In this example, information about gene expression is read from a file into a Sequence Numeric Map.
# The upregulated genes with positive fold-change are stored in a collection, and the largest positive
# fold-change value is also extracted from the map. The number of upregulated genes along with the most
# extreme fold-change value are reported in custom output format using a template stored in a Text Variable.
# Notice how the template text refers to the data objects by enclosing their names in curly braces.
GeneExpression = new Sequence Numeric Map(File:"...")
UpregulatedGenes = new Sequence Collection(Map:GeneExpression>0)
HighestValue = extract "top value" from GeneExpression as Numeric Variable

TemplateText = new Text Variable("{UpregulatedGenes:size} genes were upregulated with maximum fold-change {HighestValue}")
Output1 = output TemplateText in Template format

Text manipulation

MotifLab v2 introduced several new ways to manipulate the contents of a Text Variable with the extract and replace operations.

Replace or add text

The "replace" operation can be used to replace parts of the text matching a regular expression with a new text or to add new lines to the beginning or end of the Text Variable

# Searches for the given text in the Text Variable and replaces every matching instance with a new text
replace "search expression" with "replacement text" in TextVariable1

# Adds a new line of text to the beginning of the Text Variable.
# The text can contain \t for TABs or \n to split it over multiple lines
replace beginning with "new line of text" in TextVariable1

# Adds a new line of text to the end of the Text Variable.
# The text can contain \t for TABs or \n to split it over multiple lines
replace end with "new line of text" in TextVariable1


List operations

The following extract-functions treat the Text Variable as an ordered list of elements (lines) that could possibly contain duplicate entries.

# Sorts the lines of List1 according to a natural sort order
List2 = extract "sorted" from List1 as Text Variable

# Reverses the order of the lines in List1
List2 = extract "reverse" from List1 as Text Variable

# Returns a new list where duplicate lines in the original have been removed
# so that all entries in the new list are now unique
List2 = extract "unique" from List1 as Text Variable

# Returns a list containing only those elements that occur multiple times in List1
# (each duplicate is only listed once in the new list)
List2 = extract "duplicates" from List1 as Text Variable

# Takes all the lines from List2 and adds them to the end of List1
List3 = extract "append:List2" from List1 as Text Variable

# Returns only those lines from List1 that contain the specified search text (or not)
List2 = extract "lines containing:<text>" from List1 as Text Variable
List2 = extract "lines not containing:<text>" from List1 as Text Variable

# Returns only those lines from List1 that match the specified regular expression (or not)
# Note that the expression must match the full line, not just parts of it, so if you want to
# search for text that could occur anywhere within a line you must begin and end the regex with ".*"
List2 = extract "lines matching:<regex>" from List1 as Text Variable
List2 = extract "lines not matching:<regex>" from List1 as Text Variable


Set operations

These extract-functions treat Text Variables as a mathematical sets (member collections), or rather as a cross between a set and a list.
If both Set1 and Set2 in the examples only have unique entries, these functions will behave exactly as the regular mathematical set operations. However, if Set1 contains duplicate entries, these will normally be retained unless they are qualified for removal by the operation itself.

# Finds all elements from Set2 that are not already present in Set1 and adds them to the end of Set1
Set3 = extract "union:Set2" from Set1 as Text Variable

# Removes all elements from Set1 that are also present in Set2
Set3 = extract "subtract:Set2" from Set1 as Text Variable

# Removes all elements from Set1 that are not present in Set2
Set3 = extract "intersect:Set2" from Set1 as Text Variable

# Finds all elements from Set2 that are not already present in Set1 and adds them to the end of Set1.
# However, elements that are present in both sets will be removed from the result.
# If Set2 contains duplicates not found in Set1, these will be added as duplicates.
Set3 = extract "xor:Set2" from Set1 as Text Variable


Table operations

These extract-functions treat the Text Variable as a table with each line representing a row and with columns separated by TABs.

The columns function can be used to create new tables based on a subset of the columns in the original table, or to reorder columns or even introduce new columns. This function takes a comma-separated list of column indices as input. The special column index "end" can be used to refer to the last column in the table in cases where the size of the table is not known beforehand. The index "end-1" refers to the second to last column and "end-n" refers to the n'th column before the last. Ranges of contiguous columns can be defined with "start index:end index". If the start index is greater than the end index, the order of the columns will be reversed. If any index falls outside the boundaries of the table (index ≤ 0 or index ≥ end), the index (or whole range) will simply be skipped. A new column, containing a fixed value for all rows, can be introduced by including a text value (enclosed in single quotes) rather than a regular column index in the list at any point.

# Transposes Table1 so that the original rows becomes columns in the new table and vice versa
Table2 = extract "transpose" from Table1 as Text Variable

# Creates a new table based on columns 2, 4 and 5 from Table1 (assuming it has at least 5 columns)
Table2 = extract "columns: 2,4,5" from Table1 as Text Variable

# Creates a new table based on columns 1 and 2 from Table1, followed by columns 3 through 5
# and then the last three columns (end-2, end-1 and end).
Table2 = extract "columns: 1,2,3:5,end-2:end" from Table1 as Text Variable

# Reverses the order of all the columns in Table1
Table2 = extract "columns: end:1" from Table1 as Text Variable

# Creates a new table based on columns 1, 6, 5 and 4 from Table1,
# then a new column containing the value "1000" in all rows and finally column 1 is repeated once more.
Table2 = extract "columns: 1,6:4,'1000',1" from Table1 as Text Variable

It is also possible to create a table by concatenating columns from multiple Text Variables using the new operation.
# Creates a new Text Variable table with three columns based on the specified Text Variables
Table1 = new Text Variable(columns:TextVar1, TextVar2, TextVar3)



Background Model

Background models define probability distributions for DNA sequences. These can be simple (0-order) models that only contain information about the relative frequencies of the four DNA bases in the sequence or they can be higher-order Markov models (up to order 5) where the probability of observing a particular base at a position in a sequence will depend on which bases that preceeded it. For a Markov model of order N the Background Model will store information about the relative frequency of every oligo of length N (of which there are 4N) and also a transition matrix of size 4N×4 which states the probabilities that a given oligo of length N will be followed by either an A, C, G or T respectively. In addition, the model will also contain information about the single nucleotide frequency of each of the four DNA bases.

Creating Background Models

Background models can be defined manually by explicitly listing all the oligo frequencies and transition probabilities, but this is not recommended for higher-order models since it would involve too much tedious typing that can be hard to do correctly. A better way to create background models is to derive them from DNA sequence tracks. MotifLab also comes bundled with several predefined background models (borrowed from the INCLUSive project) that can be easily imported, and background models can be imported from files in various formats.

# Import the predefined "EDP_human_3" background model that comes bundled with MotifLab
EDPhuman3 = new Background Model(Model:EDP_human_3)

# Import a background model from file in MEME background format
BGmodel = new Background Model(File:"C:\mouse.freq", Format=MEME_Background)

# Create a new 0-order model with uniform distribution
UniformBG = new Background Model

# Manually define a 0-order model with high GC-content (A=10%, C=40%, G=40%, T=10%)
High_GC_background = new Background Model(SNF:0.1,0.4,0.4,0.1;MATRIX:0.1,0.4,0.4,0.1)

# Create a new 3-order background model derived from a DNA track.
# Use the DNA strand relative to the sequence orientation
Background1 = new Background Model(Track:DNA, Order=3, Strand=Relative)

Modifying Background Models

Background models are immutable data objects and cannot be changed after they have been created.

Using Background Models

Background models can be used by some motif discovery and motif scanning tools to correct for background bias when searching for transcription factor binding sites. Background models can also be used to create new artifical DNA sequence tracks or mask portions of existing DNA tracks.

# Use the "EDP_human_3" model to correct for background bias when discovering motifs with MEME
[TFBS,MEMEmotifs] = motifDiscovery in DNA with MEME {Background=EDP_human_3, ... }

# Replace bases inside TFBS regions with new bases randomly sampled from the distribution defined
# in "Background1". This will in effect destroy these binding motifs in the sequence.
mask DNA with Background1 where inside TFBS

# Create a new artificial DNA sequence track by randomly sampling bases
# according to the distribution defined in the background model
DNA_random = new DNA Sequence Dataset(EDP_human_3)



Expression Profile

An Expression Profile is a data table primarily meant to hold gene expression profiles, wherein each sequence (gene) can be associated with multiple numeric values for different conditions. It can be thought of as a two-dimensional extension of the Sequence Numeric Map, where each column in the table corresponds to a SNM. The columns of the table are referred to as conditions (or sometimes experiments). By default, the conditions are numbered (starting at 1), but they can also be given explicit names. It is possible for some columns to have names and others to just have default numbers, but it is not recommended to mix these styles (especially since you can give a column a number as an explicit name, which can be confusing).

Creating Expression Profiles

Expression Profiles can be created manually, either by explicitly assigning condition values to sequences, by basing the profile on a list of Sequence Numeric Maps, or by basing it on a subset of conditions from another existing profile.

To create an expression profile in the GUI, select "Add New ⇒ Expression Profile" from the "Data" menu or press the plus-button in the Data Objects Panel and select "Expression Profile" from the context menu. You can then edit the values in the table. The new profile will start off with only one column, but you can add more by pressing the "Add condition" button in the dialog. To rename a condition, right-click on the column header and select "Rename" from the context-menu.

In a protocol, you can create a profile by assigning a comma-separated list of values to each sequence. Each sequence must have the same number of values, and the sequence entries should be separated by semicolons. Existing sequences that are not included in the list will have their values set to 0 for all conditions by default. You can assign names to the conditions by including entries on the form "header[column number]=<name>;".

Examples
# Create an expression profile with four conditions (numbered 1, 2, 3 and 4)
# Only the two listed sequences will have explicitly assigned values, and all other sequences
# will default to zero for all conditions
ExpressionProfile1 = new Expression Profile(ENSG00000100345=2.4,0.3,-0.2,0.5;ENSG00000111249=1.8,-0.4,0.1,1.2)

# Same as above, but now the second and fourth columns/conditions are given explicit names,
# so the conditions will now be named: 1, Case, 3, Control
ExpressionProfile2 = new Expression Profile(header[2]=Case;header[4]=Control;
                                            ENSG00000100345=2.4,0.3,-0.2,0.5;ENSG00000111249=1.8,-0.4,0.1,1.2)

Creating Expression Profiles from a list of Sequence Numeric Maps
In a protocol, Expression Profiles can be created from a comma-separated list of Sequence Numeric Maps. The names of the conditions/columns will be based on the names of the maps.

# Create a profile based on the three maps. The columns will be called: Sample1, Sample2 and Sample3
ExpressionProfile3 = new Expression Profile(Map:Sample1, Sample2, Sample3)
Creating Expression Profiles based on a subset of another profile
A new Expression Profile can be created by cherry-picking conditions from another profile. This is accomplished with the extract operation using the "subprofile:" property. You can extract a comma-separated list of named or numbered columns, and it is also possible to define column ranges on the format "firstColumn-lastColumn" (or "firstColumn:lastColumn"). If the last column in a range is located before the first column in the original profile table, the order of the columns in the range will be reversed in the final profile. Columns that have explicitly assigned names (even if these names are numbers) in the original profile will retain their names in the new profile as well, but columns that just have default column numbers will not retain these numbers. So if you extract columns "3,5,6" from a profile with just default numbered columns, they will be numbered "1,2,3" in the new profile. Note that a column with an explicit name can not be added twice to a second profile.

Examples
# Create a new profile based on the first four columns of Profile1 (assuming default numbering)
Profile2 = extract "subprofile:1,2,3,4" from Profile1 as Expression Profile

# Another way to create a new profile based on the first four columns of Profile1 using a column range
Profile3 = extract "subprofile:1-4" from Profile1 as Expression Profile

# Create a new profile based on the first four columns of Profile1 but in reversed order
Profile4 = extract "subprofile:4-1" from Profile1 as Expression Profile

# Create a new profile based on the column named "Case" followed by columns 3 through 5 and then the column "Control"
Profile5 = extract "subprofile:Case,3-5,Control" from Profile1 as Expression Profile
Importing Expression Profiles from files
You can import an expression profile from file by selecting "Import Data..." from the "Data" menu and then choosing "Expression Profile" from the type drop-down menu in the dialog, or by pressing the plus-button in the Data Objects Panel, selecting "Expression Profile" from the context menu and then going to the "Import" tab in the dialog. Three data formats are currently supported for expression profiles: ExpressionProfile, ExcelProfile and Plain. Note that condition names are not supported by the Plain format.

Modifying Expression Profiles

Similar to Numeric Maps, values in Expression Profiles can be set explicitly with the set operation or changed relative to the current values with the arithmetic operations increase, decrease, multiply and divide. Expression Profiles can also be transformed with threshold and transform. Note that, like Numeric Maps, these operations can be limited to a subset of the sequences in the profile, but it is currently not possible to limit the application of the operation to a subset of conditions. Hence, when modifying the profile, all the values for a sequence will be updated. It is also not currently possible to modify a profile using a second profile, for instance to subtract the values in one profile from the values of second profile.

# Increase all the values in the expression profile by 0.2
increase ExpressionProfile1 by 0.2

# Multiply the gene expression values for each sequence by its corresponding value in the map
# (all values for the same sequence will be multiplied by the same value across all conditions in the profile)
multiply ExpressionProfile2 by SequenceNumericMap1

# Set all the profile values to 0 for sequences in the Downregulated set (across all conditions)
set ExpressionProfile1 to 0 in collection Downregulated

Using Expression Profiles

The main use of Expression Profiles is as additional input to motif discovery programs or other external programs that can use this type of information to improve their analysis. However, so far no such programs are supported.



Priors Generator

A Priors Generator (PG) is an object that can estimate an a priori probability that a position in a sequence could be associated with a specific feature. This estimate is usually based on the values of other feature tracks that correlate with the target feature. PG objects can be used to create position-specific priors tracks (aka "positional priors") that display a prior probability of finding a certain feature, such as TF binding sites, at each position in a sequence. When such tracks are used as input to e.g. motif discovery or motif scanning tools, they can guide the tools to the parts of the sequence that are more likely to contain the target feature and thereby help them make better predictions.

Creating Priors Generators

Priors Generators are usually trained by supervised machine learning methods to predict the presence of a target feature based on a set of input features, for instance predicting the possible presence of TF binding sites based on features such as sequence conservation, DNase hypersensitivity, and various histone marks (H3K4me3, H3K4me1, etc.)

The MotifLab GUI includes a "wizard" to train a PG in a few steps, but in order to do that you need to have a training dataset with annotated regions of the feature you want to predict as well as access to additional feature tracks that can be used as input to predict the target feature. To create a new PG, select "Add New ⇒ Priors Generator" from the "Data" menu or press the plus-button in the Data Objects panel and select "Priors Generator" from the drop-down menu.

The Priors Generator dialog will let you import a finished, pre-trained PG from a file, to re-train a new PG based on predefined configuration or to create a completely new PG in 3 steps, as described below.

Training a new Priors Generator

Step 1: Selecting the target features, input feature and classifier

The target feature is the feature that you want the Priors Generator to be able to predict. In order to train the PG you must already have a region dataset with correctly annotated regions for that feature, which is selected with the drop-down menu in the top-left part of the dialog. The input features that you will use to predict the target are selected from the list underneath. This list will be populated with all the other region and numeric feature datasets that you currently have. The selected input features should ideally show at least some correlation with the target, either alone or in combination, or else it will be impossible to use them for prediction.

The right-hand side of the first panel configures the classifier(s) – the machine learning methods you will use for the prediction. You can add a classifier by first selecting the type from the drop-down menu and then pressing the "Add new" button in front of it. Three types of classifiers are currently included in MotifLab: neural networks, naive Bayes classifiers and decision trees. You can edit the properties of a classifier you have already added (such as the number of hidden layers and nodes in a neural network) by selecting it in the list and pressing the "Edit" button. It is possible add multiple classifiers, and these will then be combined into an ensemble classifier that is trained using an adaptive boosting approach.
When you are satisfied with your selections at this step, press the "Next" button to move on to the second step.



Step 2: Setting up the training and validation datasets

The second step involves setting up a dataset that will be used for training the classifier(s) as well as an independent validation dataset that can be used to verify that the classifier(s) are able to generalize well to new cases they have not seen before.

Technically, every position in all your sequences could be used as training examples, but since training with a very large dataset is extremely resource demanding, it is wiser to select a smaller subset of positions to use a training examples. The number of positions to sample for the training set is selected in the top-right box, and the sampling strategy is selected in the top-left drop-down menu (and visualized underneath with red segments indicating target feature regions, white is background and the black marks below are sampled positions). The possible ways to sample are:
  • Random sampling: The specified number of positions are sampled with uniform random sampling. The number of examples in the positive set (target feature) and negative set (background) should be approximately proportional to their fractional sizes in the sequences.
  • Evenly spaced: The specified number of training examples are sampled at equidistant positions in the sequences. The number of examples in the positive set (target feature) and negative set (background) should be proportional to their fractional sizes in the sequences.
  • Evenly spaced within each class: The specified number of training examples are sampled at equidistant positions in the sequences but with different distances inside the target feature and in the background, so that the number of positive and negative training examples will end up to be roughly the same.
  • All positive, random negative: All positions in the sequences that fall within the target feature are used as positive training set, and the remaining background is sampled in a uniformly random way for negative training examples up to the specified number of samples.
  • All positive, evenly spaced negative: All positions in the sequences that fall within the target feature are used as positive training set, and the remaining background is sampled at equidistant positions for negative training examples up to the specified number of samples.
  • Midpoint of each sequence: Only the middle point of each sequence will be used as a training example, and for each sequence the midpoint could either correspond to a positive example (if the point is within a feature region) or a negative example (if in the background).
  • Import from file: The training examples are not sampled from the current feature dataset, but are rather imported from a file in Attribute-Relation File Format.
The sampling process could be restricted to a subset of the current sequences, and it is also possible to remove "duplicate" training examples afterwards (these are examples that have the same values for all features as another example). The validation dataset could be sampled in the same ways as the training dataset (but it is then recommended to sample these two sets on different subsets of the sequences to avoid overlap), or the validation dataset could be created from the training dataset by extracting a subset of the training examples afterwards.



After you have made your selections at this step, press the "Next" button to start the sampling process and create the datasets. When the datasets are finished, MotifLab will display a popup dialog showing you the number of positive and negative examples in each of the datasets. If you are satisfied, press the "Yes" button to move on to the final step, or press "No" to go back and try sampling again. If you like, you can also save the datasets at this point (in Attribute-Relation File Format).


Step 3: Training the classifiers

The last step is to train the classifier(s). The only thing you usually need to do here is to press the "Train" button to start the training.

If you are training an ensemble with multiple classifiers, the "sampling" setting can control how to adjust the training set for the different classifiers by using "weighted examples". When this option is employed (by selecting either "weighted" or "stochastic universal" sampling), the first classifier will be trained on the full training set, and each example that it classifies correctly will have its associated "weight" reduced. When the next classifier is to be trained, a new training set of the same size is constructed by sampling – with replacement – from the original set in such a way that examples with higher weights have a higher chance or being selected (possibly even multiple times). This means that the new training set will be focused more towards the training examples that the previous classifiers failed to classify correctly. The selection of training examples could be done by repeatedly sampling each example to include at random with a probability proportional to its relative weight ("weighted"), which should on average result in each training example being selected a number of times which is proportional to its weigth, but in extreme cases the selection could be skewed. The "stochastic universal" sampling strategy, on the other hand, only uses one round of sampling and guarantees that each example is included in a number proportional to its weight. For instance, if you have 4 training examples with weights 4.0, 2.0, 1.0 and 1.0, the new dataset should, on average, include 2 copies of the first example (since the weight of this example amounts to 50% of the total weight), one copy of the second example, and one copy of either the third or fourth example. The "stochastic universal" sampling strategy will ensure that this really will be the result, but with the more random "weighted" strategy, you could in theory end up selecting four copies of the last example.

If a classifier is trained over multiple iterations, you will be able to see the progress of the classifier over time in the top graph, where the blue line shows the performance on the training set and the red line on the validation set. The performance is measured by accuracy, i.e. the fraction of correctly classified examples (ie. (TP+TN)/(TP+TN+FP+FN) ). This fraction is also showed in the table and beneath the pie charts. If the classifier is not refined over multiple iterations, you will only see the final performance after the training process is finished.

The two pie charts show the results on the training and validation sets. The green colors indicate examples that were correctly classified, whereas the red indicate the proportion of examples that were misclassified. The darker (more saturated) colors represent the positive examples (target feature) whether these were correctly classified (green) or not (red), whereas the lighter colors represent the negative examples (background) that were either correctly (light green) or incorrectly classified (light red). Or in other words: Dark green = True Positives (TP), Light green = True Negatives (TN), Light red = False Positives (FP) and Dark red = False Negatives (FN).



When the training process is finished, the "Train" button will turn into a "Save" button, and you will have to save the Priors Generator before you can finish the process. The main reason for this is that Priors Generators are too complex to describe in a single line in a protocol, so the protocol has to save all the required information to a separate file that it can then reference. The PG can be saved either "as is" in its current trained form, or you can save a configuration file describing all the selections you have made in the two first steps (example). MotifLab will then re-train a new PG on-the-fly as needed based on this configuration setup when the protocol is executed.

If you are not satisfied with the final performance of the PG and want to try training it again (before saving), you can press the "<Back" button once and the "Save" button will then go back to being a "Train" button again. If you press "<Back" a second time, you will be taken back to the previous step.

Initializing Priors Generators in a protocol
# Importing a pre-trained Priors Generator from file
PriorsGenerator1 = new Priors Generator {File:"C:\MotifLab\PG_for_predicting_TFBS.pge", format=PriorsGeneratorFormat }

# Importing a configuration file describing how to create a Priors Generator
# After importing the file, MotifLab will train a new PG on-the-fly based on the description
PriorsGenerator2 = new Priors Generator {Configuration:"C:\MotifLab\PriorsGenerator_config.xml"}

When a Priors Generator is created from a configuration file in a protocol, the configuration file describes how to sample the training and validation datasets. However, it is possible to override these dataset settings individually by addings extra parameters in "parameterName=value" format. The parameter name should be on the form "dataset.property", where dataset is either "trainingset" or "validationset" and property is one of the following:
  • sampling: This is the sampling strategy. The allowed values are (case-sensitive):
    • Full sequence
    • Random sampling
    • Evenly spaced
    • Evenly spaced within each class
    • All positive random negative
    • All positive evenly spaced negative
    • Midpoint of each sequence
    • Import data from file
    • Subset of training set
  • samples: The number of training/validation examples to draw (integer number)
  • subset: The name of a Sequence Collection. Examples will only be drawn from this subset.
  • remove_duplicates: This can either be "true" or "false" (default)
  • filename: The path to the dataset file (if training/validation examples are imported from file)

Example with dataset overrides     (See also this example)
# Importing a configuration file describing how to create a Priors Generator
# Irrespective of what is stated in the configuration file, the number of samples used for the training set
# will be 2000 and duplicate examples will not be removed
PriorsGenerator2 = new Priors Generator {Configuration:"C:\MotifLab\PriorsGenerator_config.xml",                                          trainingset.samples=2000, remove_duplicates=true }


Once a PG has been created, you can inspect it by double-clicking on the PG in the Data Objects panel. The figure below shows a Priors Generator based on a single neural network classifier that was trained to predict a track with "TFBS" regions based on 10 different input features (listed in the panel on the left). At each sequence position, the values from these feature tracks will be used as input to the nodes in the top layer (blue). The information provided by these feature values will then be processed by the network (which here has a single hidden layer with 8 nodes) before a final probability value is output by the single node at the bottom of the network.


Using Priors Generators

Priors Generators can be used by the predict operation to create tracks with positional priors. If the PG was trained to create priors by combining information from several input tracks, these tracks (with the same names but not necessarily from the same sequence locations) must also be available when running the predict operation. (However, the target track used during training is not needed for this step).



Analysis

An analysis is a complex data object containing results produced by the analyze operation. Different types of analyses will produce different subtypes of Analysis objects.

Creating Analyses

An analysis can only be created as output by the analyze operation or returned by some external programs. For some types of compatible analyses, information can be extracted from several analyses and combined into a new analysis using the collate operation.

Examples
# Analyzes the GC-content of a DNA track and returns the value for each sequence as well as summary statistics
Analysis1 = analyze GC-content {DNA track = DNA }

# Analyzes the correlation (Pearson's and Spearman's) between two compatible numeric maps
Analysis2 = analyze numeric map correlation {First = Map1, Second = Map2 }

# Counts the number of times each TF motif occurs in a TFBS track and compares these numbers to expected frequencies
Analysis3 = analyze count motif occurrences {Motif track = TFBS, Motifs = JASPAR, Expected frequencies = FreqMap }

# Analyzes the positional distribution of individual motifs in the TFBS track relative to the TSS of each sequence
Analysis4 = analyze motif position distribution {Motif track = TFBS, Motifs = JASPAR, Alignment anchor = "TSS" }

# Combines two columns of information from Analysis3 (total and p-value) with one column from Analysis4 (Kurtosis)
# to create a new an "bigger" analysis object
Analysis5 = collate "total" from Analysis3, "p-value" from Analysis3, "Kurtosis" from Analysis4

Modifying analyses

An analysis data object is meant to represent the final output produced at the very end of a processing workflow. As such, it is not designed to be manipulated further.

Using analyses

The information contained in Analysis objects can be inspected by researchers and provide evidence for existing hypotheses or perhaps suggest new ones. Analyses can also be output to documents in various formats, e.g. Excel and HTML with graphs and tables, and these figures can be often be included directly in scientific publications. For example, in the MotifLab paper, figures 3 and 5 were produced by the benchmark analysis, whereas figure 4 was produced by the evaluate prior analysis. Figure 6 shows a table with data collated from multiple analyses.

Analysis objects can be viewed in the GUI by double-clicking on an Analysis in the Data Objects panel (or right-clicking and selecting "Display ..." from the context menu). This will open a dialog to display the information contained in the analysis object. These displays can often be interactive. For example, some will only display parts of the information, so the user will have to select which parts to view (using e.g. drop-down boxes). Analyses that includes tables can usually be searched or filtered, and analyses that displays results (graphs and/or tables) for various tracks will often only include the tracks that are currently visible in the GUI (i.e. not "hidden"). The user can therefore decide which results to include in the graph by toggling the visibility of the tracks (although usually you will have to close the Analysis dialog and reopen it again to update the graphs).



Output Data

An Output Data object is a document in some specific data format. It is mostly just used to represent the information held by other data objects in text based formats that can later be saved to files, since data objects in MotifLab cannot otherwise be saved to files directly (in their internal representation). Output Data objects can also hold more complex documents containing extensive reports, in for example HTML format, that can contain embedded content, such as e.g. images.

Output Data objects are displayed in separate tabs in the main panel of the GUI, with the tabs themselves showing the names of the data objects. The contents of Output Data objects can be saved to files by selecting either "Save", "Save As..." or "Save All" from the file menu. Unless otherwise specified, the names of the output files will be based on the names of the data objects, and the file suffix will be determined from the data format used when creating the Output Data object. If MotifLab is run in CLI-mode, all Output Data objects created during the execution of the protocol (that have not been explicitly deleted) will automatically be saved to files afterwards, unless the "-no_output" option is specified.

In the GUI, individual Output objects can be deleted by clicking on the close icons of their tabs, and you can delete all Output objects by selecting "Close All Output Panels" from the "View" menu or by selecting either "Clear Data ⇒ Other Data" or "Clear All Data" from the "Data" menu.

Output Data objects can be of three main types: text ("raw text"), HTML or binary formats. The first two of these can be displayed directly in MotifLab's GUI, but documents in binary formats (e.g. Excel formats or PDF) cannot be displayed by MotifLab. However, binary formatted documents can still be saved to files and reopened later in external viewers, such as Excel or Adobe Acrobat.

Creating Output Data

Output Data objects can only be created from other data objects using the output operation after selecting which format to use. Objects in most "raw text" formats will allow their documents to be appended to later, but binary and HTML-formatted documents will not.

Examples
# Output the contents of a DNA track object (feature dataset) in FASTA format
Output1 = output DNA in FASTA format

# If no target Output Data object is specified, the output will be stored in an object called "Results"
output DNA in Plain format

# First output the contents of a TFBS track object in BED format to the Output Data object "Output2",
# then append the contents of a second TFBS track in GFF format to the same document
Output2 = output TFBS in FASTA format
Output2 = output TFBS2 in GFF format

# Output the contents of a DNA track object (feature dataset) in FASTA format
Output1 = output DNA in FASTA format

Modifying Output Data

If the current contents of an Output Data object allows it, new text can be appended to the end of the document by applying additional output operations that write to the same Output Data object. However, existing parts of a document cannot be modified after they have been added.

Using Output Data

Output Data objects can be viewed by the user in MotifLab's GUI. This can be nice for analysis output and similar report-like documents, but the main purpose of most Output Data objects is just to function as temporary storage of another data object in a format that can be saved to file. Like Text Variables, Output Data objects containing text in a supported input data format can also be parsed to create other objects with the new operation.
HTML dependencies
Output Data objects in HTML formats may include embedded content, such as images, CSS style sheets and JavaScript (JS) files, that must also be saved – perhaps to separate files – when the HTML document itself is saved. How this is done is controlled in different ways.

CSS and JavaScript
The way CSS and JS content is handled can be controlled by selecting "Options..." from the "Configure" menu and then going to the "HTML" tab.
  • None: CSS and/or JS will not be included at all. This may result in some functionality not working properly.
  • Shared File: CSS will be saved to a file named "motiflab_style.css" and JavaScript will be saved to "motiflab_script.js" in the same directory as the main output file. If these files exist already, they will not be created anew. This means that if you save additional HTML files to the same directory, they can all share these CSS/JS-files.
  • New File: CSS and/or JS will always be saved to new files named after the main output file with an added incremental number suffix. E.g. if the main file is called "report.html", the dependencies could be named "report_1.js" and "report_2.css".
  • Link: The HTML document will reference CSS and/or JS files located on the MotifLab web server. This will save some disc space locally but may be risky if the MotifLab web server goes down.
  • Embed: CSS and/or JS will be included directly in the HTML document itself rather than being stored in separated files.
The style sheet to use can be chosen in the same dialog by selecting a CSS-file from disc, or by selecting one of the predefined style sheets included with MotifLab (currently only [default] and [green]).

Motif logos (and module logos)
Motif logos are graphical representations of the binding preferences for different nucleotide bases each at each position in the TF motif. Many analyses contain tables with results for individual motifs, and when outputting such analyses in HTML format, the logos for these motifs can optionally be included as images. The way this is done is usually decided when executing the output operation using the "Logos" data format parameter.
  • No: Motif logos (or module logos) will not be included in the output at all.
  • Text: Rather than a colorful graphical representation, the logos will rendered using pure text instead (for example as an IUPAC consensus sequence). No extra image files will be saved with this option.
  • Shared Files: The motif/module logos will be saved to files named after the motifs/modules themselves in the same directory as the main output file. If files with the same names already exist in that directory they will not be created anew. This means that if you save additional HTML files to the same directory that also include logos for the same motifs/modules, they can all share these image files.
  • New Files: The motif/module logos will always be saved to new image files named after the main output file with an added incremental number suffix. E.g. if the main file is called "report.html", the logo files could be called "report_3.gif", "report_4.gif", report_5.gif", etc.






Operations

Introduction

MotifLab users can apply operations to create, manipulate and analyze data objects. The behaviour of these operations can be controlled with arguments and by specifying conditions to limit their application. Commands to execute different operations can also be combined into protocol scripts that define multi-step workflows.

The operations available in MotifLab can broadly be divided into the following groups:

General: This group includes general operations to create, copy, delete and output data objects
Transform: Transform operations take a data object as input and modifies it (or alternatively returns a new data object of the same type with the modifications)
Derive: The operations in this group take one or more data objects as input and use the information to derive a new data object (usually of a different type)
Combine: These operations combine information from several data objects of the same type (or different but compatible types) into a single new data object
Motif: This group includes operations that create, manipulate and use motifs and motif tracks
Module: This group includes operations that create, manipulate and use modules and module tracks
Sequence: This group includes operations that manipulate sequences
Analyze: This group contains only a single operation – analyze – that can be used to perform different types of analyses and return the results as Analysis data objects


Operation arguments

Operations take arguments that can be used to control the behaviour of the operation. Most operations require a source data argument which specifies the data object(s) the operation should be applied to, and many operations also allow, or even require, a target data argument specifying the (name of the) data object the results from the operation should be stored in. Additional optional or required arguments may have to be provided depending on the particular operations, and applying conditions to an operation will call for specification of still more arguments. For example, the increase operation takes two required arguments: a source argument specifying which data object to increase and a second argument specifying how much to increase the value of the source data object by.

The type of values allowed for an argument will depend on the function of that particular argument, but the values can typically be data objects (perhaps limited to specific data types), numeric values or text values. When an argument calls for a numeric value, this can usually be provided as a numeric constant or with a numeric data object such as a Numeric Variable or a Numeric Map. Likewise, if an argument calls for a text value, this can normally be provided as a literal text string (usually enclosed in double quotes) or with a Text Variable or Text Map.

Using Maps as arguments

The use of maps to provide values for arguments in operations warrants some explanation. A map is a data object which describes an association between basic data objects (motif, module or sequence) and their respective values (which can be either numerical or textual depending on the type of map). The map can be thought of as a table with two columns, the first column listing the names of data objects and the second column containing the associated value. In this way it is possible to use the map to look up the value for each data object. When maps are used as arguments, the particular values used by the operation will depend on the "natural context". Consider, for example, the command "increase TFBS by NumericMap1". Assuming that TFBS refers to a motif track (or alternatively a module track), this operation will go through all regions in all sequences in the track and increase the score property of each region by a certain amount which can be found in the map. Now, if NumericMap1 is a Sequence Numeric Map, the value to use for the argument can be found by looking up the name of the "parent sequence" in the map (i.e. the sequence the region belongs to). This means that all the regions belonging to the same sequence will have their scores increased by the same amount, but regions belonging to different sequences could potentially be increased by different values. If, on the other hand, the NumericMap1 argument was a Motif Numeric Map (or Module Numeric Map), then the type property of each region (which in this case should correspond to the name of a Motif or Module) would be used to look up the value to use from the map. The result would be that all regions associated with the same motif/module would have their scores increased by the same amount, even for regions belonging to different sequences. Sometimes it is allowed to use maps in situations where the correct context cannot be properly determined. In these cases the default value of the map will be used. The default map value will also be used if the sequence/motif/module does not have an explicitly assigned value in the map.

A note on coordinates and orientations

In MotifLab, genomic segments can be represented at three different levels that give rise to different coordinate systems and anchor points.
  1. Genome    (genomic coordinates)
  2. Sequence    (relative coordinates)
  3. Region    (region coordinates)


The genome of a species is divided into one or more chromosomes each having a coordinate system starting at position 1.
For instance, the 115Mbp long chromosome 13 of the human genome can be described with coordinates "chr13:1-115169878".

Sequences are objects representing (sub)segments of chromosomes ranging in size from 1bp up to the full length of the chromosome, although they are mostly used to represent smaller regions of interest, such as e.g. genes or upstream promoter regions of genes. In the figure above, the first sequence ENSG00000035403 represents a segment around the transcription start site of the gene VCL and the second sequence ENSG00000100345 represents a segment around the TSS of gene MYH9. Since VCL is located on the direct strand, the corresponding sequence is also located on the direct strand as indicated by the green arrow pointing towards the right underneath the sequence name. The MYH9 gene, on the other hand, is located on the reverse strand and so the arrow underneath its sequence name points towards the left. Both sequences are visualized here relative to their annotated orientation, which means that the upstream direction in both cases is to the left and the downstream direction is to the right. (It is possible to visualize sequence in either orientation. When sequences are visualized in the opposite orientation of their annotated strand, the arrow underneath the sequence name is shown in red color rather than green).

The location of sequences are always stored internally in MotifLab using genomic coordinates relative to the direct strand of the chromosome, and so the "genomic start" of a sequence (also simply called "start") is its smallest genomic coordinate and the "genomic end" of a sequence (or just "end") is its largest genomic coordinate. This applies irrespective of the actual orientation of the sequences. Hence, in the figure above, the "start" of the first sequence is to the left and the "end" is to the right. However, for the second sequence which is located on the reverse strand, the "start" is located to the right and the "end" is on the left.

Relative coordinates, on the other hand, are always seen relative to the orientation of the sequence itself, which means that the "relative start" of a sequence is its most upstream coordinate and the "relative end" is its most downstream coordinate. For sequences on the direct strand, the relative coordinates are exactly the same as the genomic coordinates, but for sequences on the reverse strand the "relative start" corresponds to the "genomic end" and the "relative end" corresponds to the "genomic start".

To make matters more confusing, sequences can also contain smaller regions that can have their own orientations independent of their parent sequences. The orientation of a TFBS region, for example, will be determined by the orientation of its corresponding binding motif model. When region tracks are visualized with region orientations, the track will be divided into two parts by a horizontal line. Regions in the top half have the same relative orientation as their parent sequence (they are located on the same strand as the sequence), and regions in the bottom half are located on the opposite strand of their parent sequence. For regions, as for sequences, the genomic coordinates "start" and "end" correspond to the smallest and largest genomic coordinates respectively, whereas the relative coordinates are seen relative to the orientation of the parent sequence. Hence, the relative start is always the most upstream coordinate relative to the sequence (left edge of the regions in the figure) and the relative end is the most downstream coordinate (right edge of the regions in the figure).

In the region coordinates system, the coordinates are seen relative to the orientation of the regions themselves rather than the orientation of the genome or parent sequence. The "region start" is thus considered to be the first position in the region and the "region end" is the last position within the region. For example, if a region represents the binding sequence "ACAAGT" then the region start is the position of the first base "A" and the region end is the position of the last base "T". (The DNA sequence will depend on the orientation of the parent sequence). In the figure above, the "region start" position corresponds to the left edge of regions in the upper half of the track and to the right edge of regions in the bottom half.

Conditions

Feature Conditions

Feature conditions are conditions that can be placed on feature dataset operations to limit the application of the operation to certain positions (for DNA sequences and numeric datasets) or regions (for Region datasets). In protocols such conditions are introduced by the keyword "where" following the operation and its arguments.

For example, the following command (without a condition) will apply the mask operation to every position in the DNA sequence and replace every base with the letter "N".
   mask DNA with "N"   

By specifying a condition we can limit the application of the operation to specific parts of the sequence. In the example below the DNA sequence will only be masked inside annotated repeat regions (from the RepeatMasker track).
   mask DNA with "N" where inside RepeatMasker   

It is possible to specify multiple conditions for the same operation by connecting them into compound conditions using the boolean operators AND and OR.

Position Conditions

The position condition applies to DNA tracks and Numeric tracks and is evaluated for each individual position in a sequence.
Operations will only be applied to positions where the condition holds true. The general syntax for this type of condition in protocols is as follows:

   where [not] <OperandTrack> <operator> [<Operand2>]   

If the optional not keyword is specified immediately after "where", the truth value of the whole condition following it will be inverted. The operand track referred to within the condition itself does not have to be the same as the target track that the operation is applied to, and this operand can be of any type (DNA, Numeric or Region track). Depending on the type of operand track chosen, different comparisons are possible as described in the tables below.

Operand track is a Numeric Dataset
OperandOperatorOperand2Description
NumericTrack1=valueThe condition holds true if the value in this position of NumericTrack1 equals the value of Operand2
NumericTrack1>=valueThe condition holds true if the value in this position of NumericTrack1 is equal to or greater than the value of Operand2
NumericTrack1>valueThe condition holds true if the value in this position of NumericTrack1 is greater than the value of Operand2
NumericTrack1<=valueThe condition holds true if the value in this position of NumericTrack1 is equal to or less than the value of Operand2
NumericTrack1<valueThe condition holds true if the value in this position of NumericTrack1 is less than the value of Operand2
NumericTrack1<>valueThe condition holds true if the value in this position of NumericTrack1 is not equal to the value of Operand2
NumericTrack1inN to MThe condition holds true if the value in this position of NumericTrack1 is between the two values N and M (inclusive)
The value(s) of Operand2 must be numeric and can be provided either as a constant number, a Numeric Variable, a Sequence Numeric Map or a (second) Numeric Dataset. If a Sequence Numeric Map is used, the value of Operand2 will be the value for the current sequence in the map. If a Numeric Dataset is used, the value of Operand2 will be the value in the corresponding position of this track (i.e. the two tracks are compared position by position).



Operand track is a DNA Sequence Dataset
OperandOperatorOperand2Description
DNATrack1equalsbase letterThe condition holds true if the DNA base in this position of DNATrack1 is equal to that of Operand2. The comparison is done in a case-insensitive way.
DNATrack1matchesIUPAC letterThe condition holds true if the DNA base in this position of DNATrack1 matches the IUPAC code of Operand2
DNATrack1case-sensitive equalsbase letterThe condition holds true if the DNA base in this position of DNATrack1 is equal to that of Operand2 and the two bases also have the same case (upper or lower)
DNATrack1is uppercase The condition holds true if the DNA base in this position of DNATrack1 is in uppercase
DNATrack1is lowercase The condition holds true if the DNA base in this position of DNATrack1 is in lowercase
DNATrack1has same case asbase letterThe condition holds true if the DNA base in this position of DNATrack1 has the same case (upper or lower) as that of Operand2
The value of Operand2 must be a single DNA base letter (or IUPAC consensus letter) which can be provided either as a literal string (enclosed in double quotes), a Text Variable or a (second) DNA track. If the value is provided as a string or Text Variable, only the first letter in the text is used even if the actual string might be longer. If a second DNA track is used, the value of Operand2 will be the value in the corresponding position of this track (i.e. the two tracks are compared position by position).

By default the comparisons use DNA bases taken from the direct strand (even if the sequence itself has reverse orientation), and this was also the only option available in MotifLab v1. In version 2.0+ of MotifLab, it is possible to use bases from the relative strand by adding the qualifier relative strand after the "equals", "matches" and "case-sensitive equals" operators.
DNATrack1equals relative strandbase letterSame as "equals" but the DNA base is taken from the reverse strand of DNATrack1 if the current sequence has reverse orientation.
DNATrack1matches relative strandIUPAC letterSame as "matches" but the DNA base is taken from the reverse strand of DNATrack1 if the current sequence has reverse orientation.
DNATrack1case-sensitive equals relative strandbase letterSame as "case-sensitive equals" but the DNA base is taken from the reverse strand of DNATrack1 if the current sequence has reverse orientation.



Operand track is a Region Dataset
OperandOperatorOperand2Description
RegionTrack1insideThe condition holds true if this position overlaps with a region in RegionTrack1
RegionTrack1bases overlapRegionTrack2The condition holds true if this position overlaps with regions in both RegionTrack1 and RegionTrack2
RegionTrack1bases not overlapRegionTrack2The condition holds true if this position overlaps with a region in RegionTrack1 but not with a region in RegionTrack2
RegionTrack1regions overlapRegionTrack2The condition holds true if this position overlaps with a region in RegionTrack1 and that region also overlaps with a region in RegionTrack2 (although not necessarily at this position). The condition thus holds true for all positions within regions of RegionTrack1 that overlap with regions in RegionTrack2
RegionTrack1regions not overlapRegionTrack2The condition holds true if this position overlaps with a region in RegionTrack1 and that region does not overlap with a region in RegionTrack2. The condition thus holds true for all positions within regions of RegionTrack1 that do not overlap with regions in RegionTrack2

Illustration:
The black regions indicate the bases where the condition holds true for the different comparison operators when the operand is a Region Dataset.


Examples:

# Sets all values above 0.5 in the Conservation track to 1.0
set Conservation to 1.0 where Conservation > 0.5

# Locates all positions of the track PhastCons46way where the value is less than the corresponding value of PhastCons46wayPlacental and sets these positions to 0
set PhastCons46way to 0 where PhastCons46way < PhastCons46wayPlacental

# Doubles the values of the Conservation track inside of CpG-island region
multiply Conservation by 2 where inside CpG_islands

# Doubles the values of the Conservation track outside of gene regions
multiply Conservation by 2 where not inside EnsembleGenes

# Performs repeat masking on the DNA track by replacing bases with N's inside repeat regions
mask DNA with 'N' where inside RepeatMasker



Region Conditions

The region condition applies to Region Datasets and is evaluated for each individual region in a sequence. Operations will only be applied to regions where the condition holds true. Three different subtypes of region conditions exist. The first type bases the condition on the value of a specific property of the region itself. The second type compares the region to other regions from the same or a different region track. The last type bases the condition on the values of a numeric track within the sequence segment spanned by the region. The general protocol syntax for these three cases are as follows:

   where [not] region <property> <operator> <Operand>   
   where [not] region <operator> <RegionTrack> [ <comparator> <Operand2> ]    
   where [not] region <operator> <NumericTrack> <comparator> <Operand2>   

The region keyword discriminates this kind of condition from the position condition. For improved language in protocols, the alternative forms region's, regions and regions' are also accepted. If the optional not keyword is specified immediately after "where", the truth value of the whole condition following it will be inverted.


Conditions based on region properties
PropertyOperatorOperandDescription
text property "name"equalsTextThe condition holds true if the region's value for this property is identical to the text value of the operand
text property "name"matchesTextThe condition holds true if the region's value for this property matches the value of the operand (which can be a regex)
text property "name"is inSetThe condition holds true if the region's value for this property is identical to one of the values in the set
text property "name"matches inSetThe condition holds true if the region's value for this property matches one of the values in the set (which can contain regexes)
numeric property "name"=valueThe condition holds true if the region's value for this property equals the value of the operand
numeric property "name">=valueThe condition holds true if the region's value for this property is equal to or greater than the value of the operand
numeric property "name">valueThe condition holds true if the region's value for this property is greater than the value of the operand
numeric property "name"<=valueThe condition holds true if the region's value for this property is equal to or less than the value of the operand
numeric property "name"<valueThe condition holds true if the region's value for this property is less than the value of the operand
numeric property "name"<>valueThe condition holds true if the region's value for this property is not equal to the value of the operand
numeric property "name"inN to MThe condition holds true if the region's value for this property is between the two values N and M (inclusive)
The specification of the property must include its type (text, boolean or numeric) and the name of the property within double quotes. (Boolean properties are treated the same as text properties except that their values are expected to be boolean). The three standard properties "type" (text), "score" (numeric) and "length" (numeric) are exempt from this rule and can be referred to by the short-hand notation "where region type|score|length ...".

For numeric properties, the value(s) of the operand must be numeric and can be provided either as a constant number, a Numeric Variable or a Numeric Map. If a Motif- or Module Numeric Map is used as the operand, the type property of the region will be used as the key to look up the corresponding value in the map. If a Sequence Numeric Map is used, the value of the operand will be the value for the current sequence in the map.

For text properties, the operand can either be a constant string enclosed in double quotes, a Text Variable, a Collection or a Text Map. If a Motif- or Module Map is used as the operand, the type property of the region will be used as the key to look up the corresponding value in the map. If a Sequence Map is used, the value of the operand will be the value for the current sequence in the map. The "equals" and "matches" operators expect the operand to be a single value that must match with the property. The only difference between these two is that "matches" allows the operand to be/contain a regular expression (as explained here). Note that the property value is expected to match the full regular expression, so if you want to target regions where the property contains some specific substring (e.g. "AP1") the regex must allow for optional characters before or after this substring (like so ".*AP1.*"). (Regex matching is case-insensitive.) The "is in" and "matches in" operators expect the operand to be a set with multiple values, for instance a Text Variable with multiple lines (each line will be treated as a separate value), a Collection or a Text Map (which possibly contains multiple comma-separated values for each entry).

NB: If a region does not have a defined value for the property, the following default values will be used: 0 (numeric properties), an empty string (text properties) or FALSE (boolean properties).



Conditions based on comparison with other regions
OperatorTrackcompOp2Description
present inRegionTrack2The condition holds true for this region if RegionTrack2 contains a region which is identical in every respect to this region (both standard and user-defined properties must match!)
similar inRegionTrack2The condition holds true for this region if RegionTrack2 contains a region with the same location, orientation and type as this region
overlapsRegionTrack2The condition holds true for this region if it overlaps with a region in RegionTrack2
insideRegionTrack2The condition holds true for this region if it is wholly inside (i.e. completely covered by) a region in RegionTrack2
coversRegionTrack2The condition holds true for this region if it completely covers a region in RegionTrack2
distance to anyRegionTrack2•valueThe condition holds true for this region if RegionTrack2 contains a region located within the specified distance from this region
distance to closestRegionTrack2•valueThe condition holds true for this region if the closest region in RegionTrack2 is located within the specified distance from this region
The distance between two regions is the number of bases between them, so two regions that lie back to back have a distance of zero. Overlapping regions have a defined distance of -1. For the distance operators the value of Operand2 must be numeric and can be provided as usual with a constant number, Numeric Variable or Numeric Map. The comparator (•) can be any one of the standard numeric comparison operators: =, <, <=, >, >= or "in N to M" as described above.

Although compound conditions allow multiple conditions to be linked with AND/OR, these conditions are treated completely independent of each other, and it is not currently possible to make crossreferences between conditions. Hence, it is not possible to formulate general conditions on the form "where (this region overlaps RegionTrack2) AND (the overlapping region from RegionTrack2 satisfies some other condition)". However, it is possible to make use of a few predefined qualifiers to place further constraints on the regions in RegionTrack2.

The following two qualifiers can be placed between the operator and the track name for all operators except "present in" and "similar in".
  • type-equal: The region from RegionTrack2 must have the same "type" property as this region
  • type-matching: The region from RegionTrack2 must have a "type" property which contains the type of this region. The type property of the other region could possibly be a list with several entries (note that this matching does not allow regular expressions).

The special keyword "interaction partner" can be used instead of the name of a second region track for the distance operators.
  • interaction partner: This only applies if the target track is a motif track. The other region (which will be from the same track) must be an annotated interaction partner of the first region. (i.e. the "type" property of the region must be a motif name and this Motif must have the type of the other region annotated in its "interactions" list).



Condition based on values from a numeric track within the region
OperatorTrackcompOp2Description
minNumericTrack•valueThe condition holds true for this region if the smallest value from the numeric track within the region satisfies the comparison
maxNumericTrack•valueThe condition holds true for this region if the largest value from the numeric track within the region satisfies the comparison
averageNumericTrack•valueThe condition holds true for this region if the average value from the numeric track over all positions within the region satisfies the comparison
medianNumericTrack•valueThe condition holds true for this region if the median value from the numeric track of all positions within the region satisfies the comparison
sumNumericTrack•valueThe condition holds true for this region if the sum of all values from the numeric track over all positions within the region satisfies the comparison
weighted averageNumericTrack•valueThe condition holds true for this region if the motif IC-weighted average value from the numeric track over all positions within the region satisfies the comparison
weighted sumNumericTrack•valueThe condition holds true for this region if the motif IC-weighted sum of all values from the numeric track over all positions within the region satisfies the comparison
startValueNumericTrack•valueThe condition holds true for this region if the value from the numeric track in the (genomic) start position of the region satisfies the comparison
endValueNumericTrack•valueThe condition holds true for this region if the value from the numeric track in the (genomic) end position of the region satisfies the comparison
centerValueNumericTrack•valueThe condition holds true for this region if the value from the numeric track in the middle position of the region satisfies the comparison
relativeStartValueNumericTrack•valueThe condition holds true for this region if the value from the numeric track in the most upstream position of the region (relative to the parent sequence) satisfies the comparison
relativeEndValueNumericTrack•valueThe condition holds true for this region if the value from the numeric track in the most downstream position of the region (relative to the parent sequence) satisfies the comparison
regionStartValueNumericTrack•valueThe condition holds true for this region if the value from the numeric track in the first position of the region (relative to the orientation of the region itself) satisfies the comparison
regionEndValueNumericTrack•valueThe condition holds true for this region if the value from the numeric track in the last position of the region (relative to the orientation of the region itself) satisfies the comparison
The weighted sum and average only works for motif tracks where each region is associated with a Motif. In these cases the values from the numeric track will be weighted by the information content of the corresponding position in the motif.



Examples:

# Removes repeat regions shorter than 100 bp
filter RepeatMasker where region's length < 100

# Removes TFBS regions with scores different from 0
filter TFBS where region's numeric property "score" <> 0

# Removes TFBS regions falling within annotated repeats
filter TFBS where region inside RepeatMasker

# Removes regions from TFBS that overlaps with region of the same type in TFBS2
filter TFBS where region overlaps type-equal TFBS2

# Removes TFBS that lie further away than 100 bp from closest gene
filter TFBS where region's distance to closest EnsemblGene > 100   

# Removes TFBS that do not have a second non-overlapping binding site for a known interaction partner within 20 bp
filter TFBS where not region's distance to any interaction partner in 0 to 20   

# Removes TFBS that have a low conservation level
filter TFBS where region's average Conservation < 0.4



Compound Conditions

It is possible to define multiple feature conditions for an operation by connecting two or more individual conditions into compound conditions using the boolean operators AND and OR.

When conditions are connected with AND, the full compound condition is only satisfied when all of the individual conditions are satisfied.
   where <condition1> AND <condition2>   

With the OR operator, the full compound condition is satisfied if at least one of the individual conditions are satisfied.
   where <condition1> OR <condition2>   

When more than two conditions are connected using both operators, the AND operator takes precedence over OR.
Hence, in the example below, the full condition is satisfied if either condition 1, or condition 4, or both conditions 2 and 3 are satisfied.
   where <condition1> OR <condition2> AND <condition3> OR <condition4>   

Parentheses can be used to group conditions together and indicate alternative orders of operations. Conditions can be nested to arbitrary levels.
   where (<condition1> OR <condition2>) AND (<condition3> OR (<condition4> AND <condition5>))   

Although it is possible to negate the truth value of individual conditions with the not operator, it is not (currently) possible to negate compound conditions directly. A condition on the form "where not X and Y" will be read as "where (not X) and Y" rather than "where not (X and Y)" and parentheses can not be used to achieve the latter. To negate a compound condition, the condition must instead be rephrased as two or more separately negated conditions following De Morgan's laws.
  • not (condition1 AND condition2) = (not condition1) OR (not condition2)
  • not (condition1 OR condition2) = (not condition1) AND (not condition2)

Defining compound conditions in the GUI

To add more than one condition to an operation, press the small plus-button at the far right side of the Operation dialog.

The regular view will then be replaced with a larger box where all the conditions are organized in a tree structure.
All the conditions belonging to a group are listed below the operator that connects them. The image below shows one (top-level) group of conditions connected by AND.


By default, conditions will be combined with AND, but you can change the operator by right-clicking on it and selecting "Change Operator to:" from the context-menu. To add a new condition to a group, right-click on an operator in the tree and select "Add New Condition to Group". If you choose "Add to New Group", the current group will be nested beneath a new parent group where the conditions are connected by the chosen boolean operator.


To edit an individual condition or remove a condition from a group, right-click on the condition itself and choose "edit" or "remove" respectively from the context-menu. If you choose "Add to New Group", the selected condition will instead be added to a nested subgroup connected by the chosen boolean operator.


Groups of conditions are shown below (and indented with respect to) the operator that connects them. In the example below, the conditions at the top level are connected by AND. This includes the first condition and a nested group connected by OR (bottom two conditions). This tree structure thus corresponds to the condition "where (region inside RepeatMasker AND (region's average Conservation < 0.5 OR region's type is in Upregulated))". You can expand or collapse nested subgroups if you like by clicking on the arrow before the operators.


Selection Windows

Selection windows can be used to limit operations on feature datasets to within manually defined sequence segments. These segments will usually be selected in the GUI using the selection tool. Whenever selection windows are defined on one or more sequences, the operation dialog may contain an additional checkbox that allows the operation to be limited to these selection windows. The selection windows themselves are listed in the textbox behind the checkbox. Each selection window is defined on the form "sequencename:start-end" (where start and end are genomic coordinates).


Within protocols, selection window conditions are introduced by the keyword "within" followed by the list of selection windows enclosed in brackets. If other types of conditions are also applied to the same operation, the selection windows condition should always be last.
   mask DNA with "N" within [ Seq1:134123-135123, Seq2:254431-255431, Seq3:25519-26519 ]   


Subset Conditions

Subset conditions can be used to limit operations on feature datasets to a subset of the sequences or to limit transformations of maps to a subset of the entries. The subset must be defined as a collection (of the applicable type) which can be then be selected from a drop-down menu in operation dialogs.


Within protocols, subset conditions are introduced by the keyword "in collection" followed by the name of the collection. If other types of conditions are also applied to the same operation, the subset condition should be listed after feature conditions but before selection windows.
   mask DNA with "N" in collection Upregulated   




Individual Operations

analyze

The "analyze" operation performs a chosen analysis and returns an Analysis object containing the results. The Analysis object can be inspected in MotifLab's graphical user interface or it can be output to a text document, either in HTML-format (possibly containing graphs and other images) or in a "raw" format which will be suitable for parsing by other programs. In MotifLab v2, analyses can also be output in Excel format. Note that for some analyses, the output may change depending on the current visualization settings. For instance, the Benchmark analysis (and several others) will use the foreground colors of tracks when drawing charts, and hidden tracks will not be included in the output. Information from multiple analyses that operate on the same type of data objects may sometimes be combined into a single analysis with the help of the collate operation.



Arguments
NameDescription
analysis The specific analysis to perform.
analysis-specific parameters Each specific analysis will have its own parameters that must be set. See the documentation for the individual analyses for further explanation of these parameters.

Examples:

# Analyses the GC-content in the specified DNA track
Analysis1 = analyze GC-content {DNA track=DNA}

# Compares two numeric maps to see if the values for corresponding entries in the maps are correlated (here motif size is compared against motif information content)
Analysis2 = analyze numeric map correlation {First=Motif_size,Second=Motif_IC}


See also: benchmark, compare clusters to collection, compare collections, compare motif occurrences, compare motif track to numeric track, compare region datasets, compare region occurrences, count module occurrences, count motif occurrences, count region occurrences, evaluate prior, GC-content, motif collection statistics, motif position distribution, motif regression, motif similarity, numeric dataset distribution, numeric map correlation, numeric map distribution, region dataset coverage, single motif regression, collate


apply

The "apply" operation will apply a sliding window function to a Numeric Dataset to smooth the track or to find peaks, valleys or edges in the data. The operation goes through each position in the track in turn and defines a "window" region around each target position. The selected window function dictates how a new numeric value can be calculated based on the values of the positions within the current window, and the resulting value is assigned to the target position.



Arguments
NameDescription
window function The different window functions define how new values can be calculated based on the values of all positions within the window.
  • The "Uniform", "Bartlett" and "Gaussian" windows return different weighted averages of the values within the window.
  • The "Sum" window simply returns the total sum of values within the window.
  • The "Minimum" and "Maximum" windows return the minimum and maximum value within the window respectively.
  • The "Shift" window will return the value of the most downstream position within the window if the "start" or "center" anchors are used or the value of the most upstream position if the "end" anchor is used. This means that for a window with size N, the "start" anchor will shift the values in the track N-1 positions upstream, and the "end" anchor will shift the track N-1 positions downstream.
  • The "Valley" and "Valley2" windows can be used to detect valleys in the data track. That is, sections of the track with low values that are located inbetween sections with high values. The valley-score is based on the definition used in the paper: Ramsey & Shmulevich et al. (2010) "Genome-wide histone acetylation data improve prediction of mammalian transcription factor binding sites", Bioinformatics, 26(17) : 2071-2075. The sliding window is divided into three parts with different sizes, the left 40%, the central 20% and the right 40%, and the highest values within both the left and right flanks are determined. The smallest of these two maximum scores from the left and right flanks is hereafter referred to as "minofmax". If the score in the center point is less than 90% of minofmax, then the center point is considered to be a "valley-point" and is assigned a value greater than zero. If, however, the score in the center is within 10% of the minofmax-value, it is not a valley-point and is assigned a value of zero. The difference between the "Valley" and "Valley2" windows is that with "Valley" the new assigned value for the valley-point will just be the "minofmax" (lowest value in the two flanks), but with "Valley2" the valley-point will be assigned a value reflecting the difference between the minofmax and the previous value (this means that the new value will be proportional to the depth of the valley). It is advisable to use these windows in combination with the "center" anchor and an odd-numbered window size to avoid shifting the location of the valleys.
  • The "Peak" window can be used to detect narrow peaks in the data track. This window functions in basically the same way as the Valley-windows but with opposite results. If the value in a position is much higher than the "maxofmin" in the flanks, the current value will be kept as is. If not, the position will be assigned the value zero. This means that wide sections with similar values will be set to zero, but narrow peaks in the track that have much higher values than the surrounding sequence will be retained. It is advisable to use this window in combination with the "center" anchor and an odd-numbered window size to avoid shifting the location of the peaks.
  • The "Edge" window can be used to detect sharp transitions in the data track. The returned value will simply be the value of the last position in the window minus the value in the first position. This means that positive gradients in the original track will result in positive values in the new track and negative gradients will result in negative values.
sizeThe size of the sliding window
anchor The anchor parameter controls how the window should be placed in relation to the target position. The "center" anchor will place the window so that the target position is in the center of the window. The "start" anchor will place the window so that the target position is in the first position of the window (most upstream position in a relative orientation). The "end" anchor will place the window so that the target position is in the last position of the window (most downstream position in a relative orientation).

Conditions: position condition

Examples:

# Smooths the track by replacing the value in each position with the (unweighted) average of the values within a 10 bp region centered on the position
apply Uniform window of size 10 with anchor at center to NumericTrack

# Shifts the track 5 bases upstream (not 6 bases!)
apply Shift window of size 6 with anchor at start to NumericTrack

# Removes (i.e. sets to zero) sections in the track that do not correspond to narrow peak regions
apply Peak window of size 41 with anchor at center to NumericTrack




collate

The collate operation can be used to combine information from several different analyses (or Maps) by extracting columns of data from each analysis and putting them together in a larger table. A collated analysis is based around a fundamental data type (Motif, Module or Sequence) and contains rows for each of the data objects of that fundamental type. Only information from analyses and maps that have compatible fundamental types can be collated, and additional properties from the fundamental data objects themselves can also be included in the final table.



Arguments
NameDescription
data type The fundamental data type that the source analyses and maps contain information about (Motif, Module or Sequence)
source The source analysis, map or fundamental data type from which a column of data should be extracted and inserted into the collated analysis. If the source is a map, the values from the map are used, but if the source is an analysis or a data type, the property (column) to be extracted must be specified explicitly. You can include as many sources as you want in the collated analysis to build a table with many columns.
property If the corresponding source is an analysis or fundamental data type (not a Map), the column to be extracted from the analysis or property to use from the data type must be specified with this argument.
column name A new name to be given to the column in the collated analysis. If no new column name is specified, the old name of the column/property from the source object is used. Note that each column in the collated analysis must have a unique name, so if you want to e.g. include the same column from two analysis of the same type, you must rename at least one of the columns.
optional title A new title for the collated analysis which will be displayed as a header when outputting the analysis to e.g. HTML or when showing the analysis in a dialog . The default title is just 'Collated analysis'.

Examples:

# Returns a new collated analysis with two columns containing respectively the GC-content of each sequence (extracted from Analysis1) and the length of each sequence (a property of the Sequence object)
Analysis2 = collate "GC-content" from Analysis1, "length" from Sequence

# Returns a collated analysis with three columns containing the 'total' column from Analysis1_count and also the 'total' column from Analysis2_count. This second total column is renamed to 'total2' to avoid conflict with the first column. The final column in the table contains values from the map 'ExpectedFrequency' (this column is renamed as 'Expected' in the collated table).
Analysis3 = collate "total" from Analysis1_count, "total" from Analysis2_count as "total2", ExpectedFrequency as "Expected"


See also: analyze


combine_numeric

Combines multiple Numeric Datasets into a single track, multiple numeric maps into one map or multiple variables into one variable. The value assigned to the target data object could either be based on the minimum value across all source data objects (inputs), the maximum value, the average value, the sum of values or the product of values. If the source objects are Numeric Datasets the tracks are combined position by position, i.e. the value of each position in the resulting target track will be either the minimum, maximum, average, sum or product of the values in that position across all the source datasets. If a condition is specified, only positions that satisfy the condition are combined, and positions that do not satisfy the condition are assigned the value of the first source dataset in the position. If the source objects are Numeric Maps, these will be combined across entries for the same key. E.g. for a Motif Numeric Map, the value in the target map for motif "M00001" will be based on the values for this motif in the source maps. The default values from each map will always be combined in the same way as the individual entries.



Arguments
NameDescription
function This argument specifies how the "combined" value(s) assigned to the target data object should be calculated based on the values of the source data objects. Possible choices are "min","max","average","sum" or "product".

Conditions: position condition

Examples:

# Returns a new track where the value in each position is the average of the values from the tracks X, Y and Z in that position
W = combine_numeric X,Y,Z using average

# Returns a new Motif Numeric Map where the value for each motif is the sum of values for the motif in the three source maps
MM = combine_numeric MotifMap1,MotifMap2,MotifMap3 using sum


See also: combine_region


combine_regions

Combines regions from multiple Region Datasets into a single track. Each sequence in the resulting track will contain the union of regions found in all the source datasets for that sequence.



Conditions: region condition

Examples:

# Returns a new track where each sequence contains the union of regions found in X,Y,Z for that sequence
W = combine_regions X,Y,Z


See also: combine_numeric, merge


convert

This operation can be used to convert a Numeric Dataset into a Region Dataset or vice versa. When converting a Numeric Dataset into a Region Dataset, the regions will be based on stretches of the sequence that satisfy a given condition. Hence, if no conditions are specified the resulting track will contain no regions. The most natural way to convert a numeric track into regions would probably be to create regions based on stretches of the numeric track that have values greater than zero, so this condition will be set up by default in the operation dialog. The score of each region can be specified as an argument, and this can either be a constant value (the same for each region) or the score can be based on the minimum, maximum, average, median or sum of the values of a numeric track within the region (the track used for this score would naturally, but not necessarily, be the same as the source track). When converting a Region Dataset into a Numeric Dataset, positions that are not within any regions will be assigned the value 0, and positions that are within regions can be assigned a chosen value which can be either a constant value, the value from a selected numeric track at that position, the number of regions in the source track overlapping with that position, the highest score among all regions in the source track overlapping that position, the sum of the scores of all regions in the source track overlapping that position, or the length of the longest region in the source track overlapping that position.



Arguments
NameDescription
region score Applicable when converting a Numeric Dataset into a Region Dataset. The argument selects which value to use for the score-property of the resulting regions. The score can either be specified as literal numeric constant, a Numeric Variable or a Sequence Numeric Map. Alternatively, the score can be based on the minimum/maximum/average/median/sum of values of a Numeric Dataset within the region.
numeric value Applicable when converting a Region Dataset into a Numeric Dataset. The argument defines which value positions that are within regions should receive in the resulting track (positions outside regions are given the value 0). The value could either be a literal numeric constant, a Numeric Variable or a Sequence Numeric Map (in which case all positions within a sequence will be given the same value), or it could be a Numeric Dataset (in which case the value in each position will be copied from that track). In addition to these options, four "special settings" can also be used. These are "region.count" (the value used is based on the number of regions in the source track that overlap the position), "region.highestscore" (the value used is the score of the highest scoring region in the source track among all those that overlap the position), "region.sumscore" (the value used is based on the total sum of scores for all regions in the source track that overlap the position), and "region.length" (the value used is based on the length of the longest region in the source track that overlaps the position).

Conditions: position condition or region condition

Examples:

# Returns a region track where each region corresponds to a conserved stretch of the sequence (i.e. conservation greater than zero). The score of each region is the sum total of conservation values for all positions within the region.
Conserved_regions = convert Conservation to region with region.score=sum Conservation where Conservation > 0

# Returns a numeric track where the value in each position equals the number of 'ChIP_seq_tags' regions overlapping that position
convert ChIP_seq_tags to numeric with value=region.count

# Returns a numeric track that has a value of 1.0 inside RepeatMasker regions of type 'AluJo' and a value of 0.0 everywhere else
convert RepeatMasker to numeric with value=1.0 where region's type equals "AluJo"


See also: count


copy

The "copy" operation can be used to create an identical copy of an existing data object.



Examples:

# Creates a copy of the object 'X' and calls this new copy 'Y'.
Y = copy X




count

The "count" operation counts the number of regions that overlap with a sliding window along the sequence and returns a new numeric track containing the result for each position. For each position in the sequence, the operation places a window of chosen size around that position and finds all the regions that either overlap or lie fully within this window. A value is calculated from these regions, either based on just a count of the number regions or by summing up the scores for all of these regions, and the resulting value is assigned to the position.



Arguments
NameDescription
count This parameter specifies what kind of value to return for each position. If this parameter is "number" the resulting value will be a count of the number of regions falling within the sliding window, but if the parameter is "score" the resulting value will be the total sum of the scores for all regions falling within the sliding window.
MotifLab v2 introduced the possibility of summing up values for other numeric region properties besides "score" and also a special counting function called called "IC-content" that can be used for motif tracks. This function will sum up the information content of the corresponding motif matrix columns for all motifs regions within the sliding window (note that only the positions that are actually covered by the window will be included in the IC sum).
window type The window type determines the criteria for whether a given region in the track will be considered as "falling within the window" and will thus be included when calculating the count statistic. If the window type is "overlapping" all regions that overlap at least partially with the sliding window will be considered. However, if the window type is "within" only those regions that lie fully within the sliding window (i.e. are fully covered by the window) will be considered.
window size The size of the sliding window. This can be specified as a constant number, a Numeric Variable or a Sequence Numeric Map (in which case a different window size will be used for each sequence).
anchor The anchor parameter specifies how the sliding window should be placed relative to the target position.
  • center: The window is placed so that the target position is in the center of the window
  • start: The window is placed so that the target position is at the start of a window which extends downstream
  • end: The window is placed so that the target position is at the end of a window which extends upstream

Conditions: position condition

Examples:

# Returns a new track where the value in each position reflects the number of TFBS regions overlapping a window of 20 bp centered at that position
countsTrack = count number of regions in TFBS overlapping window of size 20 with anchor at center




crop_sequences

This operation (introduced in MotifLab v2.0) will either crop the ends of the current sequences by a specified number of bases in one or both directions, or crop the sequences so that they align with the edges of the first and last regions of a specified region track. It works similarly to the "Crop Sequences" tool, but unlike that tool this operation can also be applied to a subset of the sequences.



Arguments
NameDescription
amount This parameter specifies the number of bases that the sequences should be cropped. The value can be a constant number, a Numeric Variable or a Sequence Numeric Map (in the latter case, each sequence can be cropped by a different number of bases). If no direction is specified, the sequences will be cropped by this amount at both ends (so the sequences will end up 2*amount bp shorter). Alternatively, the sequences can be cropped only at one end or by a different number of bases at the upstream and downstream ends.
use relative orientations If relative orientations are used, bases will be removed from the sequences from the "upstream" or "downstream" end (or both) relative to the orientation of each individual sequence. If relative orientations are not used, all the sequences will be treated as if they were on the direct strand and bases will either be removed from the start of the sequence (smallest genomic coordinate) or from the end (greatest genomic coordinate).
regions If this parameter specifies a region track, the sequences will be cropped so that the edges of the sequences align with the (first and last) regions of this track for each sequence. If a region extends across the edge of a sequence, the sequence will not be cropped at that end.

Examples:

# Crops all sequences by 100 bp at both ends
crop_sequences by 100 bp

# Crops the sequences in the SeqCol1 collection by 100 bp from the upstream end
crop_sequences in SeqCol1 by 100 bp from upstream end

# Crops all sequences by 100 bp from the upstream end and 200 bp from the downstream end
crop_sequences by 100 bp from upstream end and by 200 bp from downstream end

# Crops all sequences by X bp from the 'direct end' of the sequence
crop_sequences by X bp from end

# Crops all sequences so that their edges align with the edges of the (first and last) regions in the 'DNaseHS' track
crop_sequences to DNaseHS




decrease

The "decrease" operation is a subtraction operator which will decrease the value (or values) of a numeric data object by a specified amount. For Numeric Datasets the operation will be applied to all positions in the sequences, and for Numeric Maps it will be applied to all entries in the map (including the "default" value). The operation can also be applied to Region Datasets to decrease the value of numeric properties of regions or to remove strings from a "text" property. By default the operation will be applied to the "score" property of the regions unless a different property is specified.



Arguments
NameDescription
property Specifies which property of the data object to decrease. For Numeric Datasets, Numeric Maps and Numeric Variables this will simply be the "value", but for Region Datasets you can select which property of the regions to decrease or append to (the default is "score"). Note that user-defined region properties will not be shown in the drop-down list in the operation dialog, but it is still possible to type in the name other properties.
amount Specifies the amount by which the values in the source object should be decreased. If the amount is a literal number or a Numeric Variable, each potential value in the source object will be decreased by the same amount. If the source object is a Numeric Dataset and the "amount" is also a Numeric Dataset, the value of each position in the source will be decreased by the value in the same position in the "amount" dataset. If the source is a Numeric Dataset and the "amount" is a Sequence Numeric Map, the values of all positions in each sequence are decreased by the value for that sequence in the map (so each sequence is potentially decreased by a different value). If both the source and "amount" are Numeric Maps of the same type, the entries in the source map will be decreased by the corresponding values in the "amount" map. If the source is a Region Dataset and the "amount" is a Numeric Dataset, the region property can be decreased by a value derived from the values in the Numeric Dataset which are covered by the region. This value could be e.g. the minimum, maximum, average, median or sum of all values within the region or it could be the value of a single position at the center, start or end of the region ("start" and "end" refers to the lowest and highest genomic coordinates of the region with respect to the direct strand. The "relativeStart" and "relativeEnd" positions refer to the most upstream and most downstream position in the region when viewed relative to the orientation of the sequence, and the "regionStart" and "regionEnd" values refer to the most upstream and most downstream positions relative to the orientation of the region itself). If the region is a "motif" region, it is also possible to use "weighted average" or "weighted sum" where the values in each position are weighted by the information content of the motif in the corresponding position. If the operation is applied to a "text" property of a Region Dataset, the "amount" should either be a literal string enclosed in parentheses or a Text Variable. The given text entries will be removed from the existing text property if present.

Conditions: position condition or region condition

Examples:

# Decreases the value of data object X by 10. If X is a Numeric Dataset/Numeric Map/Region Dataset, all positions/entries/regions in the data object will be decreased by 10.
decrease X by 10

# Returns a new track containing the difference of the two tracks in each position
newNumericTrack = decrease Track1 by Track2

# Decreases the values for the entries in the first map by the corresponding entries in the second map
decrease Map1 by Map2

# Decreases the current 'score' property of each region in the track with the average value of the NumericTrack within the region
decrease RegionTrack[score] by average NumericTrack

# Removes the three strings 'one', 'two' and 'three' from the text-property 'numbers' of every region in the Region Dataset.
decrease RegionTrack[numbers] by "one,three"


See also: increase, multiply, divide, set


delete

The "delete" operation can be used to delete data objects that are no longer needed. Its primary use is within protocols scripts to free up memory resources. The operation can be applied to multiple target objects at once.



Examples:

# Deletes the three data objects X, Y and Z
delete X,Y,Z




difference

The "difference" operation will compare one data object to another object of the same type and return a new data object highlighting the differences between the two objects.
  • If the two objects are Numeric Datasets, the result will simply be a new numeric track containing the difference between the two tracks in each position (Track1 minus Track2).
  • Likewise, if the objects are Numeric Maps, the result will be a new Numeric Map where each entry is the difference between the value in the first map and the second map (the default values will also be compared).
  • If the objects are Region Datasets, the result will be a new Region Dataset containing regions that are present in one but not both of the tracks ("exclusive OR"). In MotifLab versions 1.x, regions that are present in the first track but not the second are assigned to the REVERSE strand in the resulting track ("removed"), whereas regions occuring in the second track but not the first are assigned to the DIRECT strand ("added"). In MotifLab versions 2.0+, the original strand orientations of the regions will be kept as they were, but each region will have an added property called "onlyIn" whose value will be the name of the only track of the two that contained that region. Unless otherwise specified, two regions will be considered identical only if every single property of the two regions match. In MotifLab 2.0 it is possible to specify that two regions should be treated as same if they have the same location, orientation and type ("compare only location and type" option) or if they have the same standard properties which also include score and sequence but not necessarily other user-defined properties ("compare only standard properties" option)
  • If the objects are DNA Sequence Datasets, the result will be returned as a Numeric Dataset where positions that are different between the two tracks have a value of 1.0 and positions with the same base in the two sequences have a value of 0.
  • If the objects are two Collections, hereafter referred to as X and Y, the result will be returned as a Partition of the same member type (i.e. if two Motif Collections are compared the result will be a Motif Partition). For MotifLab versions 1.x, this partition will contain three clusters. Entries that are members of both collections will be assigned to a cluster called "Present_in_both". Entries that are members of collection X but not of Y will be assigned to the cluster "Not_in_Y", and members of Y that are not in X will be assigned to "Not_in_X". For MotifLab versions 2.0+, the resulting partition will contain four clusters. Entries that are members of both collections will be assigned to a cluster called "Present_in_both". Entries that are members of collection X but not of Y will be assigned to the cluster "Only_in_X", and members of Y that are not in X will be assigned to "Only_in_Y". Entries that are not in either set will be assigned to the cluster "Present_in_neither".
  • If the objects are Text Maps, the result will be a new Text Map where entries that have the same values in the two maps will be set to an empty value and entries that have different values in the two maps will be set to "value1 <> value2". The default values will be compared in the same way.




Arguments
NameDescription
other The other data object that the source should be compared to. This must be of the same type as the source.

Examples:

diff = difference between NumericTrack1 and NumericTrack2


See also: compare collections, compare region datasets, numeric map correlation, compare region datasets, motif similarity, benchmark, decrease


discriminate

The "discriminate" operation takes a regular positional priors track as input and turns it into a "discriminative prior" track which takes into account the priors value of potential motifs in a set of positive sequences (expected to contain binding sites for the target TF) compared with a set of negative sequences (not expected to contain binding sites for this TF). For given k-mer sequence, the discriminative prior score is defined as the ratio between the sum of the priors scores for all the occurrences of this k-mer in the positive set versus the sum of the prior score for the occurrences of the same k-mer in both the positive and negative sets.

See the following references for more information:

Narlikar L, Gordân R and Hartemink AJ (2007) "A Nucleosome-Guided Map of Transcription Factor Binding Sites in Yeast", PLoS Computational Biology 3(11):e215

Gordân R and Hartemink A (2008) "Using DNA duplex stability information for transcription factor binding site discovery", Pacific Symposium on Biocomputing 2008:453-464



Arguments
NameDescription
positive set A set of sequences that are assumed to contain the binding motif for a common target transcription factor.
negative set A set of "background" sequences that are not assumed to contain binding motifs for the target transcription factor. The "discriminate" operation will derive a positional priors track which attempts to discriminate between the positive sequences and the negative sequences.
DNA track A DNA sequence track which will be used as the basis to discriminate between the positive and negative sequences based on the occurrence of different DNA k-mers in these two sets and their positional priors.
word size The word size parameter specifies the size of the k-mer words to consider. (This size should optimally correspond to the expected motif length.)
strand This parameter controls which DNA strand(s) to consider when enumerating the DNA k-mers. Valid options are "direct" (use genomic direct strand), "relative" (determine the strand to consider from the orientation of each individual sequence) and "both".
anchor The anchor parameter controls how to select the corresponding priors value for a k-mer in a sequence. Valid options are "start" which will use the "genomic start" of the k-mer region (i.e. the value from the position with the smallest genomic coordinate within the region) or "relative start" which will use the value from the most upstream position within the k-mer region (relative to the orientation of the sequence).

Conditions: position condition

Examples:

# Converts the track 'RegularPriorsTrack' into a discriminative priors track based on occurrences of all 8-mers from the given DNA track (both strands considered) and their previous prior values in the set TargetSequences (positive) versus BackgroundSequences (negative)
discriminativePrior = discriminate RegularPriorsTrack in TargetSequences from BackgroundSequences based on words of size 8 in DNA on both strands with anchor at relative start




distance

The "distance" operation will return a new Numeric Dataset where the value at each position in the track is determined by its distance from a selected anchor point. The anchor point can be a fixed (or relative) coordinate position, a property of the sequence (such as the upstream or downstream end of the sequence or the TSS of the associated gene), or the anchor point can be the nearest region in a selected Region Dataset.



Arguments
NameDescription
direction The direction setting, which can take on the values "upstream", "downstream" or unspecified (which is the default and means the same as "both directions"), will determine if the value in each position will be positive or negative. The default is that a position is assigned the (positive) value reflecting the number of bases between that position and the anchor position. If the "upstream" direction is specified, positions upstream of the anchor will be assigned positive values whereas positions downstream of the anchor will be assigned negative values (corresponding to calculating the distance "anchor-X" for a each position X). However, if the anchor is a Region Dataset, the value will be based on the (positive) distance to the closest upstream region in the track. If the "downstream" direction is specified, positions downstream of the anchor will be assigned positive values whereas positions upstream of the anchor will be assigned negative values (corresponding to calculating the distance "X-anchor" for a each position X). However, if the anchor is a Region Dataset, the value will be based on the (positive) distance to the closest downstream region in the track.
anchor point Decides what type of anchor to use. The anchor point can be the name of a Region Dataset (in which case the value in each position will be based on the distance to the closest region in this dataset), or it can be a literal number/Numeric Variable/Sequence Numeric Map specifying a position within the sequence (in which case the value in each position in the new track will be based on its distance from that position). In addition, four special values are recognized for referring to commonly used positions, these are "transcription start site", "transcription end site", "sequence upstream end" (first position in sequence when viewed in relative orientation) and "sequence downstream end" (last position in sequence when viewed in relative orientation).
anchor setting If the anchor point is a literal number/Numeric Variable/Sequence Numeric Map, this setting controls how this number should be interpreted relative to the sequence itself (or the chromosome). For example, an anchor point with the value "10" will be interpreted as the 11th position in the sequence (in relative orientation) if the "sequence upstream end" setting is used (the first position is position 0), or if the "chromosome start" setting is used, the value "10" will be interpreted as the 10th position in the chromosome that the sequence resides on.

Examples:

# Returns a track where the value in each position is the number of bp between that position and the position 187942 (in genomic coordinates)
distanceToTSS = distance from 187942 relative to chromosome start

# Returns a track where the value in each position is the number of bp between that position and the transcription start site of the sequence
distanceToTSS = distance from 0 relative to transcription start site

# Same as the previous example
distanceToTSS = distance from transcription start site

# Same as the previous example but the positions upstream of the TSS have positive values and the downstream positions have negative values
distanceToTSS = distance upstream from transcription start site

# Same as the previous example but the positions upstream of the TSS have negative values and the downstream positions have positive values
distanceToTSS = distance downstream from transcription start site

# Returns a track where the value in each position reflects the distance to the nearest DNase peak region
distanceToTSS = distance from DNase_peak




divide

The "divide" operation is a division operator which will divide the value (or values) of a numeric data object by a specified amount. For Numeric Datasets the operation will be applied to all positions in the sequences, and for Numeric Maps it will be applied to all entries in the map (including the "default" value). The operation can also be applied to Region Datasets to divide the value of numeric properties of regions or to remove strings from a "text" property. By default the operation will be applied to the "score" property of the regions unless a different property is specified. Note that if the "amount" argument (divisor) has a value of 0 for an entry, the division will not be carried out but the original value will be retained for that entry.



Arguments
NameDescription
property Specifies which property of the data object to divide. For Numeric Datasets, Numeric Maps and Numeric Variables this will simply be the "value", but for Region Datasets you can select which property of the regions to divide or append to (the default is "score"). Note that user-defined region properties will not be shown in the drop-down list in the operation dialog, but it is still possible to type in the name other properties.
amount Specifies the amount by which the values in the source object should be divided. If the amount is a literal number or a Numeric Variable, each potential value in the source object will be divided by the same amount. If the source object is a Numeric Dataset and the "amount" is also a Numeric Dataset, the value of each position in the source will be divided by the value in the same position in the "amount" dataset. If the source is a Numeric Dataset and the "amount" is a Sequence Numeric Map, the values of all positions in each sequence are divided by the value for that sequence in the map (so each sequence is potentially divided by a different value). If both the source and "amount" are Numeric Maps of the same type, the entries in the source map will be divided by the corresponding values in the "amount" map. If the source is a Region Dataset and the "amount" is a Numeric Dataset, the region property can be divided by a value derived from the values in the Numeric Dataset which are covered by the region. This value could be e.g. the minimum, maximum, average, median or sum of all values within the region or it could be the value of a single position at the center, start or end of the region ("start" and "end" refers to the lowest and highest genomic coordinates of the region with respect to the direct strand. The "relativeStart" and "relativeEnd" positions refer to the most upstream and most downstream position in the region when viewed relative to the orientation of the sequence, and the "regionStart" and "regionEnd" values refer to the most upstream and most downstream positions relative to the orientation of the region itself). If the region is a "motif" region, it is also possible to use "weighted average" or "weighted sum" where the values in each position are weighted by the information content of the motif in the corresponding position. If the operation is applied to a "text" property of a Region Dataset, the "amount" should either be a literal string enclosed in parentheses or a Text Variable. The given text entries will be removed from the existing text property if present.

Conditions: position condition or region condition

Examples:

# Divides the value of data object X by 10. If X is a Numeric Dataset/Numeric Map/Region Dataset, all positions/entries/regions in the data object will be divided by 10.
divide X by 10

# Returns a new track containing the quotient of the two tracks in each position
newNumericTrack = divide Track1 by Track2

# Divides the values for the entries in the first map by the corresponding entries in the second map
divide Map1 by Map2

# Divides the current 'score' property of each region in the track with the average value of the NumericTrack within the region
divide RegionTrack[score] by average NumericTrack

# Removes the three strings 'one', 'two' and 'three' from the text-property 'numbers' of every region in the Region Dataset.
divide RegionTrack[numbers] by "one,three"


See also: increase, decrease, multiply, set


drop_sequences

This operation can be used to completely delete a set of sequences that are no longer needed in subsequent analyses. The operation will delete the specified Sequence Collection and all the Sequences within that collection. Also, any other data or references related to these sequences in other Collections, Partitions, Maps or Feature Datasets will also be deleted.



Examples:

# Deletes the sequence collection 'Downregulated' along with all the sequences therein
drop_sequences Downregulated




ensemblePrediction

The "ensemblePrediction" operation takes motif/binding site predictions generated by several different motif discovery programs as input and return "consensus motifs". The operation will return both a Motif Collection containing the consensus motifs as well as a Region Dataset containing the locations of these motifs in the sequences (binding sites). The actual motif prediction will be performed by an external program, and users can select which ensemble prediction method they like to use from a list of installed programs. To configure additional ensemble prediction methods, go to the "Configure" menu in MotifLab and select "External Programs...".



Arguments
NameDescription
method The particular ensemble prediction program to use. Each individual method can have additional parameter settings. See the documentation for the method on how to set these parameters.
motif prefix The returned motifs will be assigned names starting with this prefix and followed by an incremental counter. For example, if the motif prefix is set to "MF" the returned motifs will be named "MF00001", "MF00002", "MF00003" etc. This argument is optional and the prefix will default to the name of the ensemble prediction method if not specified.
DNA-track Although the source inputs to the ensemblePrediction operation are Region Datasets, the DNA sequence might also be needed to properly set the sequence-property of the returned binding sites.

Examples:

[TFBS, Motifs] = ensemblePrediction on Sites1,Sites2,Sites3 with EMD {...}


See also: motifScanning, moduleDiscovery, moduleScanning, ensemblePrediction


execute

The "execute" operation allows MotifLab to run an external data processing program. MotifLab can pass on any data that the program requires and create new data objects based on the results output by the program. This operation can thus extend the data processing capabilities of MotifLab beyond the operations already provided. In order to run a program with this operation, the interface of the program must be described in XML-formatted configuration files. Ready-made configration files for some programs are already available from the MotifLab web site (under "Tools") or in the "External programs repository" found under "External Programs" in MotifLab's "Configure" menu.



Examples:

# Runs a program called 'CreateBackgroundModel' with the given program-specific parameters and returns a single data object output by this program.
bgmodel = execute CreateBackgroundModel {Sequence=DNA,Strand="Relative",Order=1}


See also: motifDiscovery, motifScanning, moduleDiscovery, moduleScanning, ensemblePrediction


extend

Extends the size of regions in a Region Dataset in one or both directions. The regions can be extended by a fixed number of bases, or they can be extended (one base at a time) as long as a given condition is satisfied. Note the regions will never be extended past the edge of the associated sequence.



Arguments
NameDescription
direction The extension to the region can be made in both directions (default) or just a single direction ("upstream" or "downstream"). It is also possible to extend the region in both directions independently. The directions are relative to the orientation of the associated sequence (not the orientation of the region to be extended).
amount The number of bases to extend the region by. This could either be a fixed number (specified as a literal constant, Numeric Variable or Numeric Map), or the amount can be decided by a condition (in which case the region is extended in a direction as long as the condition is satisfied).

Conditions: position condition or region condition

Examples:

# Extends the regions in the DNaseHS track by 10 bp in either direction
extend DNaseHS by 10

# Extends the regions in the DNaseHS track by X bp in the upstream direction and Y bp in the downstream direction
extend DNaseHS upstream by X, downstream by Y

# Extends the regions in the DNaseHS track in either direction as long as they do not overlap with RepeatMasker regions
extend DNaseHS while not inside RepeatMasker

# Extends the regions in the DNaseHS track in either direction until they reach a position where the Conservation track has a value of 0
extend DNaseHS until Conservation = 0




extend_sequences

This operation (introduced in MotifLab v2.0) extends the current sequences by a number of bases in one or both directions. It works similarly to the "Extend Sequences" tool, but unlike that tool the operation can also be applied to a subset of the sequences. Note that the extend_sequences operation can not be used if the sequences have associated feature annotation tracks (since MotifLab will not fill in the missing data).



Arguments
NameDescription
amount This parameter specifies the number of bases that the sequences should be extended. The value can be a constant number, a Numeric Variable or a Sequence Numeric Map (in the latter case, each sequence can be extended by a different number of bases). If no direction is specified, the sequences will be extended by this amount in both directions (so the sequences will end up 2*amount bp longer). Alternatively, the sequences can be extended only in one direction or by a different number of bases in the upstream and downstream direction.
use relative orientations If relative orientations are used, new bases will be added to the sequences in the "upstream" or "downstream" direction (or both) relative to the orientation of each individual sequence. If relative orientations are not used, all the sequences will be treated as if they were on the direct strand and the new bases will either be added "before the start" of the sequences (extending "upstream" of the smallest genomic coordinates) or "after the end" of the sequences (extending "downstream" of the greatest genomic coordinates).

Examples:

# Extends all sequences by 100 bp in both direction
extend_sequences by 100 bp

# Extends the sequences in the SeqCol1 collection by 100 bp upstream
extend_sequences in SeqCol1 by 100 bp upstream

# Extends all sequences 100 bp upstream and 200 bp downstream
extend_sequences by 100 bp upstream and by 200 bp downstream

# Extends all sequences by X bp after the end coordinate on the direct strand
extend_sequnces by X bp after end




extract

The "extract" operation will extract a value or property (and sometimes also new derived values) from an existing data object and return this information as a new data object. The value or property to be extracted must be registered as an "exported property" in the source object, and different types of data objects will export different properties. For example, it is possible to extract the value of a single entry in a Numeric Map as a Numeric Variable, or extract the "top X" entries in the map as a collection. Analysis objects often export results as Numeric Maps and Numeric Variables.



Arguments
NameDescription
property The name of the property which should be extracted from the source data. Different types of data will allow different properties to be extracted. Below are listed some of the properties that can be extracted from standard data types (the data type of the extracted object is noted in parenthesis). Note that other data objects may export other properties as well. Text enclosed in angle brackets should be replaced by a suitable value or name of a data object as noted in the description of the property. For example, a property listed as <motif> could represent the name of a motif (without the brackets).

Collections (all types)
  • "size" (Numeric Variable)
       Returns the size of the collection
  • "random <X>" (Collection)
       Returns a random subset of the collection consisting of X entries. X should be a numeric value which can be given as a literal numeric constant or a Numeric Variable.
  • "random <X>%" (Collection)
       Returns a random subset of the collection consisting of X % of the entries in the original collecion. X should be a value between 0 and 100 and can be given as a literal numeric constant or a Numeric Variable.
Sequence Collections
  • "sequence:<property>" (Sequence Map or Sequence Numeric Map)
        Extracts the value of the specified property from each sequence in the collection and returns the values in a Map. The user should declare the operation to return either a Sequence Numeric Map or a general Sequence Map depending on the type of the propery.
Motif Collections
  • "motif:<property>" (Motif Map or Motif Numeric Map)
        Extracts the value of the specified property from each motif in the collection and returns the values in a Map. The user should declare the operation to return either a Motif Numeric Map or a general Motif Map depending on the type of the propery.

  • The extraction commands below derive new motifs based on the motifs in the collection. They may take a second argument "name_suffix=<suffix>" separated from the extraction property by a semicolon (see examples below). If a suffix is provided, the newly created motifs will be named after the original motifs but with the specified suffix added to the ends of their names. If no suffix is provided, the new motifs will have the same names as the originals and thus replace them.

  • "combine:<motif>,<distance>" (Motif Collection containing newly created motifs)
        Creates a new collection of motifs by concatenating the motifs in the original collection with the named motif. If the numeric distance is greater than 0, the two motifs will be separated by a distance long gap by inserting N's between the two motifs.
  • "complement" (Motif Collection containing newly created motifs)
        Creates a new collection of motifs that are the reverse complements of the motifs in the original collection (same as "reverse" below).
  • "flank:<left>,<right>" (Motif Collection containing newlycreated motifs)
        Creates a new collection of motifs in which the motifs from the original collection are expanded by adding flanking sequences before and after the original motif. The flanking sequences may contain IUPAC degenerate base symbols
  • "inverse" (Motif Collection containing newly created motifs)
        Creates a new collection of motifs where each motif is an inverted mirror image version of the motif from the original collection. (The sequence is reversed but not reverse complemented)
  • "reverse" (Motif Collection containing newly created motifs)
        Creates a new collection of motifs that are the reverse complements of the motifs in the original collection (same as "complement" above).
  • "round" (Motif Collection containing newly created motifs)
        Creates a new collection of motifs where the values in the matrix of the original motifs are rounded to the nearest integer values.
  • "shuffle" (Motif Collection containing newly created motifs)
        Creates a new collection of motifs where the positions in the binding sequence of the original motifs are randomly shuffled (i.e. the columns in the matrices are swapped around)
  • "trim flanks:<IC-cutoff>" (Motif Collection containing newly created motifs)
        Creates a new collection of motifs by removing bases from the beginning and end of the original motifs if the information content of these bases is lower than the specified cutoff (value between 0 and 2)
  • "trim:<left>,<right>" (Motif Collection containing newly created motifs)
        Creates a new collection of motifs by removing the first left bases and the last right bases from the original motifs
Module Collections
  • "module:<property>" (Module Map or Module Numeric Map)
        Extracts the value of the specified property from each module in the collection and returns the values in a Map. The user should declare the operation to return either a Module Numeric Map or a general Module Map depending on the type of the propery.

Partitions
  • <cluster> (Collection)
       If the property is the name of a cluster in the partition, the extract operation will return a collection containing the members of the cluster.
  • "size" (Numeric Variable)
       Returns the number of entries (motifs/modules/sequences) that have been assigned to a cluster.
  • "number of clusters" (Numeric Variable)
       Returns the number of clusters in the partition
  • "cluster names" (Text Variable)
       Returns a Text Variable containing the names of all the clusters in the partition (one name on each line)
  • "cluster sizes" (Text Variable)
       Returns a Text Variable containing the names of all the clusters in the partition and their respective sizes in two columns separated by TAB.

Numeric Maps
  • <entry> (Numeric Variable)
       If the property is the name of an entry in the map (motif/module/sequence), the extract operation will return a variable containing the value for that entry.
  • "_DEFAULT_" (Numeric Variable)
       Returns the default value which is used for entries that have no explicitly assigned value in the map.
  • "top value" (Numeric Variable)
       Returns the highest value in the map (which could be the default value if some entries are unassigned)
  • "top value in <subset>" (Numeric Variable)
       Returns the highest value among the entries in the given subset collection (which could be the default value if some entries are unassigned)
  • "top:<X>" (Collection)
       Returns a collection containing the X entries which have the highest values in the map. X should be a literal numeric constant or the name of a Numeric Variable.
  • "top:<X>%" (Collection)
       Returns a collection containing the X % entries which have the highest values in the map. X should be a value between 0 and 100 and can be given as a literal numeric constant or a Numeric Variable.
  • "top:<X> in <subset>" (Collection)
       Returns a collection containing the X entries which have the highest values in the map among those in the given subset collection. X should be a literal numeric constant or the name of a Numeric Variable.
  • "top:<X>% in <subset>" (Collection)
       Returns a collection containing the X % entries which have the highest values in the map among those in the given subset collection. X should be a value between 0 and 100 and can be given as a literal numeric constant or a Numeric Variable.
  • "bottom value" (Numeric Variable)
       Returns the lowest value in the map (which could be the default value if some entries are unassigned)
  • "bottom value in <subset>" (Numeric Variable)
       Returns the lowest value among the entries in the given subset collection (which could be the default value if some entries are unassigned)
  • "bottom:<X>" (Collection)
       Returns a collection containing the X entries which have the lowest values in the map. X should be a literal numeric constant or the name of a Numeric Variable.
  • bottom:<X>%" (Collection)
       Returns a collection containing the X % entries which have the lowest values in the map. X should be a value between 0 and 100 and can be given as a literal numeric constant or a Numeric Variable.
  • "bottom:<X> in <subset>" (Collection)
       Returns a collection containing the X entries which have the lowest values in the map among those in the given subset collection. X should be a literal numeric constant or the name of a Numeric Variable.
  • "bottom:<X>% in <subset>" (Collection)
       Returns a collection containing the X % entries which have the lowest values in the map among those in the given subset collection. X should be a value between 0 and 100 and can be given as a literal numeric constant or a Numeric Variable.
  • "rank ascending" (Numeric Map)
       Returns a new Numeric Map where each entry is assigned a new value based on the ascending rank order of the values in the original map. This means that the entry which has the lowest value in the original map will be assigned the value "1" in the new map and the entry with the second lowest value will be assigned the value "2" in the new map, and so on. Tied entries (that have the same value in the original map) will be assigned the same rank value in the new map, and the next rank value will then be set to the the number of entries that have lower values. For instance, if the values in the map are "13,13,24,32,32,32,58" the corresponding ranks will be "1,1,3,4,4,4,7".
  • "rank descending" (Numeric Map)
       Returns a new Numeric Map where each entry is assigned a new value based on the descending rank order of the values in the original map. This means that the entry which has the highest value in the original map will be assigned the value "1" in the new map and the entry with the second hightest value will be assigned the value "2" in the new map, and so on.
  • "assigned entries" (Collection)
       Returns a collection of all the entries that have specifically assigned values in the map.
  • "unassigned entries" (Collection)
       Returns a collection of all the entries that do not have specifically assigned values in the map but rather relies on the default value.

Expression Profile
  • "column:<name>" (Sequence Numeric Map)
       Returns the contents of the given column in the profile as a Sequence Numeric Map. The column can either be specified by index number (starting at 1 for the first column) or by header name (if the columns have specifically assigned names).
  • "subprofile:<columns>" (Expression Profile)
       Returns a new Expression Profile object consisting of a subset of the columns in the original profile. The subprofile can be declared as a comma-separated list of columns or as a range or columns (or a combination of both). Column ranges can be specified by listing the first and last column in the range separated by either a hyphen or a colon (e.g. "firstCol-lastCol" or "firstCol:lastCol"). The columns can either be specified by index number (starting at 1 for the first column) or by header names (if the columns have specifically assigned names), and the columns will be added to the new profile in the order listed (if the first column in a range is greater than the last column, their order will be reversed. E.g. if the range "7-4" is given, the columns "7,6,5 and 4" will be added to the new profile in that order).

Background Model
  • "GG-content" (Numeric Variable)
       Returns the GC-content of the background model as a fraction between 0 and 1.

Region Dataset
  • "types" (Text Variable)
       Returns a text variable listing all the different region types encountered in this dataset
  • "start" (Region Dataset)
       Returns a new Region Dataset wherein each region in the original track has been reduced to a region of size 1 bp (all other properties are kept). The new reduced regions are positioned at the "genomic start" position of the original regions (i.e. the position within the original region that has the lowest genomic coordinate).
  • "end" (Region Dataset)
       Returns a new Region Dataset wherein each region in the original track has been reduced to a region of size 1 bp (all other properties are kept). The new reduced regions are positioned at the "genomic end" position of the original regions (i.e. the position within the original region that has the greatest genomic coordinate).
  • "relative start" (Region Dataset)
       Returns a new Region Dataset wherein each region in the original track has been reduced to a region of size 1 bp (all other properties are kept). The new reduced regions are positioned at the "relative start" position of the original regions (most upstream position). For regions in sequences from the direct strand this means the position within the original region that has the lowest genomic coordinate, and for regions in sequences from the reverse strand this means the position within the original region that has the greatest genomic coordinate.
  • "relative end" (Region Dataset)
       Returns a new Region Dataset wherein each region in the original track has been reduced to a region of size 1 bp (all other properties are kept). The new reduced regions are positioned at the "relative end" position of the original regions (most downstream position). For regions in sequences from the direct strand this means the position within the original region that has the greatest genomic coordinate, and for regions in sequences from the reverse strand this means the position within the original region that has the lowest genomic coordinate.
  • "region start" (Region Dataset)
       Returns a new Region Dataset wherein each region in the original track has been reduced to a region of size 1 bp (all other properties are kept). The new reduced regions are positioned at the start of the original region (relative to its own orientation). For regions with "direct" orientation this means the position within the original region that has the lowest genomic coordinate, and for regions with "reverse" orientation this means the position within the original region that has the greatest genomic coordinate.
  • "region end" (Region Dataset)
       Returns a new Region Dataset wherein each region in the original track has been reduced to a region of size 1 bp (all other properties are kept). The new reduced regions are positioned at the end of the original region (relative to its own orientation). For regions with "direct" orientation this means the position within the original region that has the greatest genomic coordinate, and for regions with "reverse" orientation this means the position within the original region that has the lowest genomic coordinate.
  • "center" (Region Dataset)
       Returns a new Region Dataset wherein each region in the original track has been reduced to a region of size 1 bp (all other properties are kept). The new reduced regions are positioned at the center of the original regions.
  • "TFBS" (Region Dataset)
       If the target Region Dataset is a module track with modules consisting of composite motifs (clusters of TFBSs), the extract operation will return a new motif track containing the constituent TFBSs of the modules.

Motif
  • "Alternatives" (Motif Collection)
       Returns a motif collection containing all motifs that are annotated as alternative to this motif.
  • "Interactions" (Motif Collection)
       Returns a motif collection containing all motifs that are are annotated as interacting with this motif.
  • "combine motif:<motif>,<distance>" (Motif)
        Creates a new motif by concatenating the original with the named motif. If the numeric distance is greater than 0, the two motifs will be separated by a distance long gap by inserting N's between the two motifs.
  • "complement motif" (Motif)
        Creates a new motif which is the reverse complement of original (same as "reverse" below).
  • "flank motif:<left>,<right>" (Motif)
        Creates a new motif by adding flanking sequences before and after the original motif. The flanking sequences may contain IUPAC degenerate base symbols
  • "inverse motif" (Motif)
        Creates a new motif which is the inverted mirror image of the original motif. (The sequence is reversed but not reverse complemented)
  • "reverse motif" (Motif)
        Creates a new motif which is the reverse complement of original (same as "complement" above).
  • "round motif" (Motif)
        Creates a new motif where the values in the matrix of the original motif are rounded to the nearest integer values.
  • "shuffle motif" (Motif)
        Creates a new motif where the positions in the binding sequence of the original motif are randomly shuffled (i.e. the columns in the matrix are swapped around)
  • "trim motif flanks:<IC-cutoff>" (Motif)
        Creates a new motif by removing bases from the beginning and end of the original motif if the information content of these bases is lower than the specified cutoff (value between 0 and 2)
  • "trim motif:<left>,<right>" (Motif)
        Creates a new motif by removing the first left bases and the last right bases from the original motif
data type The data type for the extracted property must be specified. Note that if the selected data type does not match the correct type of the property, an error will occur.

Examples:

# Extracts the value for the motif 'M00003' from the Motif Numeric Map and returns it as a Numeric Variable
x = extract "M00003" from MotifNumericMap1 as Numeric Variable

# Returns the highest value found in MotifNumericMap1
x = extract "top value" from MotifNumericMap1 as Numeric Variable

# Returns a new motif collection containing the 10% of motifs that have the highest values in the numeric map
motifCol = extract "top:10%" from MotifNumericMap1 as Motif Collection

# Returns a new Motif Numeric Map where the entries in the source map are ranked by ascending value
map1 = extract "rank ascending" from MotifNumericMap1 as Motif Numeric Map

# Returns the number of sequences currently known by the system (i.e. the size of the AllSequences collection)
size = extract "size" from AllSequences as Numeric Variable

# Returns a collection with 20 randomly selected sequences (or less if there are fewer than 20 sequences)
random50 = extract "random 20" from AllSequences as Sequence Collection

# Selects half of the current sequences at random and returns these as a new collection
randomHalf = extract "random 50%" from AllSequences as Sequence Collection

# Returns the GC-content of each sequence (as found by the 'GC-content' analysis) in a Sequence Numeric Map
GC = extract "GC-content" from GC_analysis as Sequence Numeric Map

# Extracts the results regarding the total number of times each motif occurs in the sequences from an analysis objects and returns this result as a Motif Numeric Map
motif_counts = extract "total" from CountMotifOccurrencesAnalysis1 as Motif Numeric Map

# Returns a Motif Numeric Map with the size of each motif in the JASPAR motif collection
motif_sizes = extract "motif:size" from JASPAR as Motif Numeric Map

# Returns a SequenceMap with the genome build of each sequence in the AllSequence collection
genomes = extract "sequence:genome" from AllSequences as Sequence Map

# Creates a new Motif based on the motif M0008 by adding the sequence CAG to the front of the motif and the (degenerate) sequence nTsG to the end
M0008_flanked = extract "flank motif: CAG,NTSG" from M00008 as Motif

# Creates a new double 'module' Motif by concatenating the motif sequence from M00008 with the motif sequence from M00051 with a 5 bp spacer between them
double_motif = extract "combine motif: M00051,5" from M00008 as Motif

# Trims the flanks of motifs in the JASPAR motif collection as long as the information content of the flanking bases is less than 0.7. Note that this will update the original motifs
JASPAR_trimmed = extract "trim flanks: 0.7" from JASPAR as Motif Collection

# Creates a new collection of motifs based on the JASPAR collection but where the positions (matrix columns) in the original motifs have been randomly reshuffled. The names of the new motifs are based on the originals but with an added '_shuffled' suffix
JASPAR_shuffled = extract "shuffle; name_suffix=_shuffled" from JASPAR as Motif Collection


See also: Data


filter

Removes regions that satisfy a given condition from a Region Dataset. If no condition is specified, all the regions in the dataset will be removed.



Conditions: region condition

Examples:

# Removes binding site regions in the TFBS track that are not very conserved (or more specifically removes regions where the average values of the positions from the Numeric Dataset 'Conservation' within a region is less than 0.2)
filter TFBS where region's average Conservation < 0.2

# Removes regions in the CpG_island track that overlap with regions in the RepeatMasker track
filter CpG_island where region overlaps RepeatMasker

# Removes binding site regions in the TFBS track that do not overlap with any DNase_peaks regions
filter TFBS where not region overlaps DNase_peaks

# Removes binding site regions in the TFBS track for motifs that are members of the collection 'MotifCollection1'
filter TFBS where region's type is in MotifCollection1




increase

The "increase" operation is an addition operator which will increase the value (or values) of a numeric data object by a specified amount. For Numeric Datasets the operation will be applied to all positions in the sequences, and for Numeric Maps it will be applied to all entries in the map (including the "default" value). The operation can also be applied to Region Datasets to increase the value of numeric properties of regions or to append new strings to a "text" property. By default the operation will be applied to the "score" property of the regions unless a different property is specified.



Arguments
NameDescription
property Specifies which property of the data object to increase. For Numeric Datasets, Numeric Maps and Numeric Variables this will simply be the "value", but for Region Datasets you can select which property of the regions to increase or append to (the default is "score"). Note that user-defined region properties will not be shown in the drop-down list in the operation dialog, but it is still possible to type in the name other properties.
amount Specifies the amount by which the values in the source object should be increased. If the amount is a literal number or a Numeric Variable, each potential value in the source object will be increased by the same amount. If the source object is a Numeric Dataset and the "amount" is also a Numeric Dataset, the value of each position in the source will be increased by the value in the same position in the "amount" dataset. If the source is a Numeric Dataset and the "amount" is a Sequence Numeric Map, the values of all positions in each sequence are increased by the value for that sequence in the map (so each sequence is potentially increased by a different value). If both the source and "amount" are Numeric Maps of the same type, the entries in the source map will be increased by the corresponding values in the "amount" map. If the source is a Region Dataset and the "amount" is a Numeric Dataset, the region property can be increased by a value derived from the values in the Numeric Dataset which are covered by the region. This value could be e.g. the minimum, maximum, average, median or sum of all values within the region or it could be the value of a single position at the center, start or end of the region ("start" and "end" refers to the lowest and highest genomic coordinates of the region with respect to the direct strand. The "relativeStart" and "relativeEnd" positions refer to the most upstream and most downstream position in the region when viewed relative to the orientation of the sequence, and the "regionStart" and "regionEnd" values refer to the most upstream and most downstream positions relative to the orientation of the region itself). If the region is a "motif" region, it is also possible to use "weighted average" or "weighted sum" where the values in each position are weighted by the information content of the motif in the corresponding position. If the operation is applied to a "text" property of a Region Dataset, the "amount" should either be a literal string enclosed in parentheses or a Text Variable. The new text entries will be appended to the existing text property (or a new property will be created). Note that if a text property contains multiple comma-separated entries, the property is treated as a "string set" and strings which are already present in the set will not be appended again.

Conditions: position condition or region condition

Examples:

# Increases the value of data object X by 10. If X is a Numeric Dataset/Numeric Map/Region Dataset, all positions/entries/regions in the data object will be increased 10.
increase X by 10

# Returns a new track containing the sum of the two tracks in each position
newNumericTrack = increase Track1 by Track2

# Increases the values for the entries in the first map by the corresponding entries in the second map
increase Map1 by Map2

# Increases the current 'score' property of each region in the track with the average value of the NumericTrack within the region
increase RegionTrack[score] by average NumericTrack

# Appends the three strings 'one', 'two' and 'three' to the text-property 'numbers' of every region in the Region Dataset. If the region already contains one of these strings they will not be appended a second time.
increase RegionTrack[numbers] by "one,two,three"


See also: decrease, multiply, divide, set


interpolate

The "interpolate" operation can be used to fill in "missing values" in a Numeric Dataset that only contains (non-zero) values for a few discrete positions. For example, if the values in the track are based on a tiling-array experiment that only returns one value for each consecutive X bp region in the sequence and only the first position in each region is assigned the value whereas the next X-1 positions are set to 0, values for the remaining positions can be filled in by interpolation. The default behaviour of the operation is to interpolate between discrete, consecutive non-zero positions in the sequence (which assumes that no position should be zero). However, it is also possible to specify a maximum distance between the non-zero positions, so that interpolation will not be performed when the distance between two consecutive non-zero positions exceed this limit. If the distance between the discrete positions that are supposed to have legitimate values is fixed and known, it is possible to specify this as a parameter. The operation will then locate the first non-zero position in the sequence and assume that the next positions to interpolate between occur periodically after this position. This means that zero-valued positions will also be allowed.



Arguments
NameDescription
method This parameter specifies what kind of interpolation method to use when interpolating between values in two positions. Currently implemented interpolation methods are:
  • zero order hold: Missing values are filled in by repeating the last encountered value in new positions
  • linear interpolation: Missing values are filled in as a straight line between the values of the two consecutive anchor positions
period If specified, the operation will interpolate between consecutive anchor positions in the numeric track where the first anchor position will be the first non-zero position in the track and the next anchor positions are assumed to occur periodically after this (the other anchors can have zero values). If a period is not specified, the operation will just interpolate between non-zero positions in the track (which can occur at variable distances).
max distance If the period parameter is not set, the operation will normally interpolate between consecutive non-zero positions in the track that can occur with any distance between them. However, if a "max distance" is specified, interpolation will only be performed between two non-zero positions if the distance between them does not exceed the specified limit. (Note that it is not possible to specify both a "period" and a "max distance" parameter)

Conditions: position condition

Examples:

# Interpolates between consecutive non-zero positions in Track1 using linear interpolation
interpolate Track1 using "linear interpolation"

# Finds the first position with a non-zero value in Track1 and repeats this value in the next 24 positions immediately following. Then finds the (possibly zero) value in the subsequent position and repeats this for another 24 positions, etc.
interpolate Track1 using "zero order hold" with period 25


See also: apply


mask

Masks bases in a DNA sequence by replacing the letters in the sequence with either upper- or lowercase versions of the original letter, a new specified letter or random bases sampled from a background model.



Arguments
NameDescription
mask type Controls how the original letters in the sequence should be substituted.
  • lowercase letters: Change the case of the bases to be masked to lowercase
  • uppercase letters: Change the case of the bases to be masked to uppercase
  • specific letter: Replace the bases to be masked with the letter specified
  • random bases: Replace the bases to be masked with new base letters that are sampled randomly from the given background model.
  • sequence property: Given a Region Dataset where the regions have a text property called "sequence" with the same length as region, parts of the DNA sequence overlapping with these regions will have the current bases replaced with these sequence strings (v2.0+).
strand Specifies which strand that should be masked, either "direct" strand or "relative" strand (for backwards compatibility the words "sequence" and "gene" can be used synonymously with "relative" in protocols). This settings is not important when masking with upper/lowercase or non-base letter. However, if the masking is done with regular base letters (either with a specific letter or by sampling from a background model) this parameter controls which strand should be assigned the chosen letter. The argument is optional and will default to "relative" strand if not specified (i.e. same orientation as the sequence).

Conditions: position condition

Examples:

# Masks out repeat regions
mask DNA with "N" where inside RepeatMasker

# Sets the DNA bases to lowercase inside coding regions
mask DNA with lowercase where inside CCDS

# Creates a new DNA sequence by sampling bases according to the background model 'Uniform'
newDNA = mask DNA on relative strand with Uniform


See also: Background Model


merge

Merges regions within each sequence that are located closer than a specified distance apart from each other. The operation can merge overlapping regions, but also regions that are separated by gaps (in which case the resulting region will cover the full span of the merged regions, including the gaps). If the merged regions have the same type, the resulting region will also have this type, else the region is assigned the type "merged". If the merged regions have the same orientation, the resulting region will also have this orientation, else the region is assigned the orientation "undetermined". The score or the resulting region will be assigned the score of the highest scoring region among those merged.



Arguments
NameDescription
distance Regions that lie closer than this distance from each other in the sequence will be merged. "Closer than 0" means that only regions overlapping with each other will be merged. "Closer than 1" will also merge regions that are located immediately adjacent to each other (with no gaps between). "Closer than 2" will also merge regions that are separated by a gap of 1 bp.
mode Possible values: "any" or "similar". This setting is not currently used.

Conditions: region condition

Examples:

# merges ChIP_Seq regions that overlap in at least one base position
merge ChIP_Seq closer than 0


See also: combine_regions


moduleDiscovery

The "moduleDiscovery" operation can be used to perform 'de novo' module discovery in a set of sequences, meaning that it can search for possible modules (combinations of binding motifs) that are present in the sequences without having prior knowledge about what the modules look like. The operation will return both a Module Collection containing the discovered modules as well as a Region Dataset containing the locations of these modules in the sequences. The actual module discovery will be performed by an external program, and users can select which module discovery method they like to use from a list of installed programs. To configure additional module discovery methods, go to the "Configure" menu in MotifLab and select "External Programs...". Note that this operation can be applied to both DNA Sequence Datasets and Region Datasets, but which type of source data to use will depend on the chosen module discovery method.



Arguments
NameDescription
method The particular module discovery program to use. Each individual method can have additional parameter settings. See the documentation for the method on how to set these parameters.
module prefix The discovered modules will be assigned names starting with this prefix and followed by an incremental counter. For example, if the module prefix is set to "MD" the discovered modules will be named "MD00001", "MD00002", "MD00003" etc. This argument is optional and the prefix will default to the name of the module discovery method if not specified.

Examples:

[Module_sites, Modules] = moduleDiscovery on TFBS with ModuleSearcher {...}


See also: moduleScanning, motifDiscovery, motifScanning, ensemblePrediction


moduleScanning

The "moduleScanning" operation can be used to search DNA sequences for matches to a set of predefined modules. The operation will return a Region Dataset containing the locations of these modules in the sequences. The actual module scanning will be performed by an external program, and users can select which module scanning method they like to use from a list of installed programs. To configure additional module scanning methods, go to the "Configure" menu in MotifLab and select "External Programs...". Note that this operation can be applied to both DNA Sequence Datasets and Region Datasets, but which type of source data to use will depend on the chosen module scanning method.



Arguments
NameDescription
method The particular module scanning program to use. Each individual method can have additional parameter settings. See the documentation for the method on how to set these parameters.

Examples:

ModuleSites = moduleScanning on TFBS with SimpleModuleScanner {...}


See also: moduleDiscovery, motifScanning, motifDiscovery, ensemblePrediction


motifDiscovery

The "motifDiscovery" operation can be used to perform 'de novo' motif discovery in a set of sequences, meaning that it can search for possible binding motifs that are present in all or several of the sequences without having prior knowledge about what the motifs looks like. The operation will return both a Motif Collection containing the discovered motifs as well as a Region Dataset containing the locations of these motifs in the sequences (binding sites). The actual motif discovery will be performed by an external program, and users can select which motif discovery method they like to use from a list of installed programs. To configure additional motif discovery methods, go to the "Configure" menu in MotifLab and select "External Programs...".



Arguments
NameDescription
method The particular motif discovery program to use. Each individual method can have additional parameter settings. See the documentation for the method on how to set these parameters.
motif prefix The discovered motifs will be assigned names starting with this prefix and followed by an incremental counter. For example, if the motif prefix is set to "MF" the discovered motifs will be named "MF00001", "MF00002", "MF00003" etc. This argument is optional and the prefix will default to the name of the motif discovery method if not specified.

Examples:

[TFBS, Motifs] = motifDiscovery on DNA with MEME {...}


See also: motifScanning, moduleDiscovery, moduleScanning, ensemblePrediction


motifScanning

The "motifScanning" operation can be used to search DNA sequences for matches to a set of known motifs. The operation will return a Region Dataset containing the locations of these motifs in the sequences (binding sites). The actual motif scanning will be performed by an external program, and users can select which motif scanning method they like to use from a list of installed programs. To configure additional motif scanning methods, go to the "Configure" menu in MotifLab and select "External Programs...".



Arguments
NameDescription
method The particular motif scanning program to use. Each individual method can have additional parameter settings. See the documentation for the method on how to set these parameters.

Examples:

TFBS = motifScanning on DNA with MATCH {...}


See also: search, motifDiscovery, moduleDiscovery, moduleScanning, ensemblePrediction


multiply

The "multiply" operation is a multiplication operator which will multiply the value (or values) of a numeric data object by a specified amount. For Numeric Datasets the operation will be applied to all positions in the sequences, and for Numeric Maps it will be applied to all entries in the map (including the "default" value). The operation can also be applied to Region Datasets to multiply the value of numeric properties of regions or to append new strings to a "text" property. By default the operation will be applied to the "score" property of the regions unless a different property is specified.



Arguments
NameDescription
property Specifies which property of the data object to multiply. For Numeric Datasets, Numeric Maps and Numeric Variables this will simply be the "value", but for Region Datasets you can select which property of the regions to multiply or append to (the default is "score"). Note that user-defined region properties will not be shown in the drop-down list in the operation dialog, but it is still possible to type in the name other properties.
amount Specifies the amount by which the values in the source object should be multiplied. If the amount is a literal number or a Numeric Variable, each potential value in the source object will be multiplied by the same amount. If the source object is a Numeric Dataset and the "amount" is also a Numeric Dataset, the value of each position in the source will be multiplied by the value in the same position in the "amount" dataset. If the source is a Numeric Dataset and the "amount" is a Sequence Numeric Map, the values of all positions in each sequence are multiplied by the value for that sequence in the map (so each sequence is potentially multiplied by a different value). If both the source and "amount" are Numeric Maps of the same type, the entries in the source map will be multiplied by the corresponding values in the "amount" map. If the source is a Region Dataset and the "amount" is a Numeric Dataset, the region property can be multiplied by a value derived from the values in the Numeric Dataset which are covered by the region. This value could be e.g. the minimum, maximum, average, median or sum of all values within the region or it could be the value of a single position at the center, start or end of the region ("start" and "end" refers to the lowest and highest genomic coordinates of the region with respect to the direct strand. The "relativeStart" and "relativeEnd" positions refer to the most upstream and most downstream position in the region when viewed relative to the orientation of the sequence, and the "regionStart" and "regionEnd" values refer to the most upstream and most downstream positions relative to the orientation of the region itself). If the region is a "motif" region, it is also possible to use "weighted average" or "weighted sum" where the values in each position are weighted by the information content of the motif in the corresponding position. If the operation is applied to a "text" property of a Region Dataset, the "amount" should either be a literal string enclosed in parentheses or a Text Variable. The new text entries will be appended to the existing text property (or a new property will be created). Note that if a text property contains multiple comma-separated entries, the property is treated as a "string set" and strings which are already present in the set will not be appended again.

Conditions: position condition or region condition

Examples:

# Multiplies the value of data object X by 10. If X is a Numeric Dataset/Numeric Map/Region Dataset, all positions/entries/regions in the data object will be multiplied by 10.
multiply X by 10

# Returns a new track containing the product of the two tracks in each position
newNumericTrack = multiply Track1 by Track2

# Multiplies the values for the entries in the first map by the corresponding entries in the second map
multiply Map1 by Map2

# Multiplies the current 'score' property of each region in the track with the average value of the NumericTrack within the region
multiply RegionTrack[score] by average NumericTrack

# Appends the three strings 'one', 'two' and 'three' to the text-property 'numbers' of every region in the Region Dataset. If the region already contains one of these strings they will not be appended a second time.
multiply RegionTrack[numbers] by "one,two,three"


See also: increase, decrease, divide, set


new

Creates a new data object according to given specifications. Exactly how to define an object depends on the type, and most types of objects can be constructed in several different ways. For instance, a background model can be created by explicitly specifying its order and all the oligo-frequencies, or it can be generated automatically based on a DNA sequence.

Two modes of creation are supported by all types of object, namely creating an object based on a file (in an applicable data format) and creating an object based on a Text Variable or Output Data object containing a similarly formatted file. The syntax for these modes are almost identical:
    NewObject = new <data type> (File:"path/to/file",  format=<formatname> {format arguments} )
    NewObject = new <data type> (Input:DataObjectName, format=<formatname> {format arguments} )
    
The data object referred to by the "Input:" mode must be either a Text Variable or Output Data object. The format arguments (enclosed in braces) are optional, and default values for that format will be used if left out. The format name is also optional, and the default format for the datatype will be used if left out (with default format arguments).



Arguments
NameDescription
data type The data type of the object to be created
initialization parameters This parameter controls how to create and initalize the data object. The parameter settings available are specific to each data type. If the parameter is left out, a default instantiation of the data type will be returned (usually an "empty" object).

Examples:

# Creates a new DNA Sequence Dataset with a value of 'A' for every position
NewTrack = new DNA Sequence Dataset('A')

# Creates a new DNA Sequence Dataset based on a background model called 'Uniform'
NewTrack = new DNA Sequence Dataset(Uniform)

# Creates a new empty Region Dataset containing no regions
NewTrack = new Region Dataset()

# Creates a new Numeric Dataset with a value of 2.0 for every position
NewTrack = new Numeric Dataset(2.0)

# Creates a new Numeric Dataset based on a preconfigured data track called 'Conservation
NewTrack = new Numeric Dataset(DataTrack:Conservation)

# Creates a new Region Dataset with regions read from file in the default format for Region Datasets (i.e. GFF)
NewTrack = new Region Dataset(File:"cpg_islands.bed")

# Creates a new Region Dataset with regions read from file in BED format
NewTrack = new Region Dataset(File:"cpg_islands.bed", format=BED)

# Creates a new Region Dataset based on a Text Variable containing GFF-formatted data
NewTrack = new Region Dataset(Input:TextVariable1, format=GFF {Position="Genomic",Orientation="Relative"})


See also: Text Variable, Output Data


normalize

The normalize operation rescales the numeric values of a data object from one range to another. The operation can currently only be applied to Numeric Datasets and Region Datasets (for the latter it will be applied to the score-property), but it will be updated in the future so that it will also work on Numeric Maps. It has two different modes of normalization: "normalize sum to one" or "normalize to range". The first mode will scale all the values so that the sum total equals 1.0 (and the values thus form a probability distribution), while the second mode will scale the values from one range ("old range") to another ("new range").



Arguments
NameDescription
mode
  • "Normalize sequence sum to 1" : Normalizes the values in a sequence by dividing each value with the sum total of all the values in the sequence
  • "Normalize values to range" : Normalizes the values in the sequence by transforming each value X according to the formula:((X-OldMin)/(OldMax-OldMin))*(NewMax-NewMin)+NewMin
range If the "normalize values to range" mode is used, the old range to scale from (usually the full range of the values in the source object) and also the new range to scale to must be specified with four parameters:
  • "old min" : The smallest value in the range to scale from
  • "old max" : The largest value in the range to scale from
  • "new min" : The smallest value in the range to scale to
  • "new max" : The largest value in the range to scale to
Note that the "old min" and "old max" values do not necessarily have to correspond to the actual min and max values in source object, although that will normally be the case. The four values can be specified as numeric constants, with Sequence Numeric Maps (in which case the range will be different for each sequence), with Numeric Variables or with the six "special values": sequence.min, sequence.max, dataset.min, dataset.max, collection.min, collection.max. The "sequence.min" and "sequence.max" values are respectively the smallest and largest values within each sequence (so if these are used the range could be different for each sequence), the "dataset.min" and "dataset.max" values are the smallest and largest values in the whole dataset, and if the operation is limited to a sequence collection, the "collection.min" and "collection.max" values will be the smallest and largest values among the sequenecs in the collection.

Conditions: position condition or region condition

Examples:

# Normalizes the values in the PositionalPriors track so that the values form a probability distribution
normalize PositionalPriors sequence sum to one

# Normalizes all the values in the Conservation track so that the previously smallest value within each sequence is set to 0 and the previously largest value is scaled to 100
normalize Conservation from range [sequence.min,sequence.max] to range [0,100]

# 'Inverts' the value range of the Conservation track by setting the previously smallest value in each sequence to the new largest value and vice versa
normalize Conservation from range [sequence.min,sequence.max] to range [sequence.max,sequence.min]




output

Outputs data items to text documents in selected data formats. The document will be wrapped in a so-called "Output Data" object and the contents of this can be saved to files. If MotifLab is run in CLI-mode (without the GUI), all Output Data objects that are created during the execution of a protocol script will automatically be saved to files after completion of the protocol (the filename will be the name of the data object with a suffix determined by the data format used). If no target Output data object is specified for the output operation, a new Output object will be created automatically and assigned a default name consisting of the prefix "Output" followed by an incremental number. If a target Output data object is specified and it already exists, the output will be appended to that object if possible. If it is not possible to append more text to this data object (because it is formatted in a data format that does not allow additional text to be appended, such as HTML-formats), the operation will end with an error. When Feature Datasets are output, the sequences will be output in the order they are currently sorted.

Graphics output
Output saved in Excel and HTML formats may include graphics, such as charts and motif logos. In Excel, these graphics will always be embedded in the file itself, but in HTML format you have a few options on how to output motif and module logos. Please refer to the HTML format documentation for more information.

Direct output
Version 2.0+ of MotifLab allows the output operation to be used to output literal text strings directly to output objects (but only within protocols). The format is: <Output object> = output "some text string...". The text string enclosed in double quotes can contain references to data objects on the form "{dataobject} and the value of the referenced object will then be included in the output as explained in the documentation for the Template and TemplateHTML data formats (the same formatting-options for referenced objects are also available). The text string can also contain TABs, newlines, double quotes and backslashes if these are properly escaped as \t, \n, \" and \\ respectively.



Arguments
NameDescription
format The data format to use for the output. The type of the data object will determine which formats are available.
output parameters Each data format can have additional format specific parameter settings. See the documentation for the data format for more information.

Examples:

# Outputs the DNA Sequence Dataset called 'DNA' in FASTA format (with default settings) to a new output object provided with a default name
output DNA in FASTA format

# Outputs regions from the TFBS track in GFF-format (with genomic rather than relative coordinates) to an Output data document called 'Sites' (or appends the output to this document if it already exists)
Sites = output TFBS in GFF format {Position="Genomic"}

# Outputs motifs in the motifcollection in a format with 4 rows and N columns (with columns separated by commas)
output MotifCollection3 in RawPSSM format {Orientation="Horizontal",Delimiter="Comma"}

# Outputs the string 'Hello world! The value of X is' followed by the actual value of the data object named X (v2.0+)
output "Hello world! The value of X is {X}!"


See also: Output Data, FASTA, GFF, EvidenceGFF, BED, WIG


physical

The "physical" operation estimates different physical properties of the DNA double helix based on local sequence composition and returns a Numeric Dataset containing a value for the selected property for each position. For each position in the sequence, the value of the physical property is estimated by examining the nucleotide composition within a window region around that position. Depending on the selected property, the resulting value is either derived directly from the base (or oligo) frequencies or it is estimated by summing up values based on a smaller sliding window (2 or 3 bases long) within the larger window region.



Arguments
NameDescription
property This parameter selects which physical property to estimate values for. Currently available properties are:
  • AT-content
  • AT-skew
  • B-DNA twist
  • bendability
  • DNA bending-stiffness
  • DNA denaturation
  • duplex disrupt energy
  • duplex free energy
  • frequency (further specified by the "oligo" parameter below)
  • GC-content
  • GC-skew
  • nucleosome position preference
  • propeller twist
  • protein-DNA twist
  • protein-induced deformability
  • stacking energy
  • Z-DNA stabilizing energy
oligo If the "property" parameter is "frequency", the "oligo" parameter specifies which oligomer pattern to determine the frequency for. The parameter value should be a string of letters (normally A,C,G,T or even N). E.g. if the "oligo" parameter is "A", the operation will calculate the frequency of "A" bases within the window and if the oligo is "CAG" the operation will calculate the local occurrence frequency of the oligomer "CAG".
window size The size of the sliding window. This can be specified as a constant number, a Numeric Variable or a Sequence Numeric Map (in which case a different window size will be used for each sequence).
anchor The anchor parameter specifies how the sliding window should be placed relative to the target position.
  • center: The window is placed so that the target position is in the center of the window
  • start: The window is placed so that the target position is at the start of a window which extends downstream
  • end: The window is placed so that the target position is at the end of a window which extends upstream

Conditions: position condition

Examples:

# Returns a new track where the value in each position reflects the local frequency of the dinucleotide 'AC' within a 50 bp region centered at that position
AC_frequency = physical property "frequency:AC" derived from DNA using window of size 50 with anchor at center




plant

The "plant" operation can be used to create artificial benchmark datasets with known TFBS regions to test the performance of motif or module discovery methods. The operation will take a DNA sequence (which can be real or artificial) as input, insert new motif sites at random locations in the sequence and return the updated DNA sequence along with a Region Dataset containing the planted sites. Either a single motif or module or a collection of up to five different (non-overlapping) motifs can be planted in each sequence according to specifications.



Arguments
NameDescription
motif or module This parameter determines which single motif or module to plant in the DNA sequences. Alternatively, a Motif Collection containing up to 5 motifs can be selected here (these will then be planted independently of each other but non-overlapping).
Plant probability A number between 0 and 1.0 specifying the probability that a motif/module will be planted in each sequence. The default value of 1.0 will plant one instance of the motif/module in each sequence whereas a value of e.g. 0.5 will only plant the motif/module in about half of the sequences.
Force plant Sometimes it can be difficult to find a good location to plant the motif/module which conforms with the specified settings. If MotifLab is not able to find a good spot for the motif after several attempts, it will normally give up and skip implanting a motif site in that sequence. However, if the "force plant" parameter is set and all else has failed, MotifLab will instead select a position at random and insert the site there even if that might violate some of the other specified settings (such as e.g. the positional priors).
Min match A number between 0 and 1.0 specifying the minimum percentage match to the motif required for an implanted TFBS sequence. Lower values means that more degenerate motif instances can be implanted.
Max match A number between 0 and 1.0 specifying the maximum percentage match to the motif required for an implanted TFBS sequence. This is usually 1.0 which means that a perfect motif match is allowed. If the value is set lower than 1.0, the motif instances will be forced to be degenerate. When a motif is to be inserted in a sequence, the DNA base to insert in each position is sampled according to motif model (frequency matrix) so that the match score between the sampled TFBS sequence and the motif is between "min match" and "max match". Note, however, that it can be very difficult or even impossible to find a TFBS sequence with a match score between these bounds, so these two parameters are only used as guidelines.
Reverse probability A value between 0 and 1.0 specifying the probability that a motif/module will be implanted on the reverse strand of the sequence. If the value is set to 0 all the motifs will be inserted on the direct strand, if the value is 1.0 all the motifs will be inserted on the reverse strand and if the value is 0.5 (default) the motif/module will be inserted on the direct strand in about half of the sequences and on the reverse strand in the others.
Use same pattern Normally, the TFBS sequence to be implanted is sampled anew from the motif model for each sequence so that there can be some variation between the binding sites. However, if the "use same pattern" parameter is set, the TFBS sequence will only be sampled once and the exact same TFBS pattern will then be planted in all the sequences.
Positional prior If this parameter is not set (default), MotifLab will select the location to implant the motif/module in the sequence uniformly at random. However, if a Numeric Dataset is provided as "positional priors", this track will be used as a frequency distribution from which to select the motif location.
Use for prior If a "positional prior" track is selected, this parameter specifies how to make use the priors track. The default setting "sum" implies that the probability of planting the motif at a given location in the sequence is determined by the sum of values for all positions in the priors track that fall within the TFBS site. If "relativeStartValue" is selected, the probability of planting the motif is determined by the priors value at the relative start of the TFBS region (value in most upstream position). If "startValue" is selected, the probability of planting the motif is determined by the priors value at the genomic start of the TFBS (value in the position with lowest genomic coordinate). If "every positive" is selected, the motif will be inserted at every position that has a positive value in the priors track. This can be useful if you want to manually specify where to plant the motifs. However, if the track contains several positive values for a sequence, the user is responsible for making sure that the positive values in the track are not located too close to each other, since that can lead to overlapping TFBS (where the newly planted TFBS will destroy the binding sequence of any previously planted TFBS at the same site).

Examples:

# Plants motif sites for M00014 in the DNA track of about 80% of the sequences. The operation returns a new DNA track called 'plantedDNA' which contains these new motif sites and also a track called 'plantedTFBS' containing regions for the planted sites. The motif binding sequence (randomly sampled from the motif) will be the same for every TFBS instance
[plantedDNA,plantedTFBS] = plant M00014 in DNA {Plant probability=0.8,Use same pattern=true}




predict

The predict operation can make use of trained Priors Generator objects to derive "positional priors" tracks where the value of each position in the track can be interpreted as a prior probability of observing a specific feature at that position. The feature which is predicted is already set in the Priors Generator and all tracks that the Priors Generator needs in order to predict the target feature must also be available in order to use the operation. These inputs are not explicitly declared but must have the same name and types as the original tracks used when training the Priors Generator. E.g. If a Priors Generator was trained to predict the locations of transcription factor binding sites, on the basis of three tracks named respectively "Conservation", "DNaseHS" and "ChipSeq", the same three tracks must also be available in order to use the predict operation with this Priors Generator.



Arguments
NameDescription
priors generator The name of the Priors Generator object to use to predict the target feature.

Examples:

# Uses the PriorsGenerator1 object to derive a new positional priors track based on a set of feature tracks
TFBS_prior = predict with PriorsGenerator1


See also: Priors Generator


prompt

The "prompt" operation can be used in protocol scripts to provide users with some control and allow them to interactively select new values for different data objects during the execution of the protocol. When a "prompt" command is encountered in the protocol, a dialog box will appear and ask the user to select a value for the data object. Note that the target data object must already exist (the prompt operation can not be used to create new data objects) but the object can be "empty". The current value of the data object will be used as the default value, and this value will be displayed to the user who can decide to keep the data object as it is or select a new value for it.



Arguments
NameDescription
message An optional message which will be displayed to the user in the popup dialog.
constraints This optional parameter was introduced in v2.0 to allow the prompt to constrain the values that can be selected for Numeric and Text Variables. The values can be limited to a specific set by explicitly listing the allowed values within curly braces, i.e. {value1,value2,...,valueN}.

If the target data object is a Text Variable and the braces contain a single entry which is the name of a Text Variable, the available options will be taken from this Text Variable (with each line representing a selectable value). If the braces are empty, the user is allowed to enter any single value for the Text Variable (but not a multi-line value).

If the target data object is a Numeric Variable, the list of allowed values can include references to other Numeric Variables as well as literal numbers. For Numeric Variables the values can also be constrained to be within a certain range by specifying the minimum and maximum values within brackets: [minimum:maximum]. An optional step argument can also be added [minimum:maximum:step]. E.g. the range [0:30:5] will limit the allowed values to 0, 5, 10, 15, 20, 25 or 30. Instead of numbers, stars (*) can be used to denote that the range should be unlimited in one of the directions, e.g. the range [5:*] means that the value must be at least 5 but there is no maximum limit. It is also possible to use references to Numeric Variables instead of literal numbers, e.g. the range [1:Limit] means that the value must at least one and at most equal to the current value of the Numeric Variable named 'Limit'.

Constrained values are usually presented in the prompt dialog using a drop-down menu (for value sets) or a spinner (for numeric ranges), but it is possible to suggest that a different type of GUI widget should be used by adding a single letter after the closing brace/bracket. Available options are:
  • M : Drop-down menu
  • L : List
  • R : Spinner (only for numeric ranges)
  • S : Slider (only for numeric ranges)
  • T : Textbox (for entering a single value for Text Variables)

Examples:

# Displays a dialog which allows the user to select a new value for the Cutoff data object
prompt for Cutoff "Enter a threshold value"

# Displays a dialog which allows the user to select a new value between 1 and 100 for the Cutoff data object using a slider
prompt for Cutoff "Enter a threshold value" [1:100]S

# Displays a dialog which allows the user to select between the two values 'absolute' or 'relative' for TextVariable1 using a drop-down menu
prompt for TextVariable1 "Select scoring function" {"absolute","relative"}M




prune

The "prune" operation can be used to remove duplicate regions from a Region Dataset. These duplicates can either be regions that are exactly identical to another region in the same track or they can be overlapping regions for motifs that are considered to be similar to each other (and hence duplicate predictions of the same TF binding site). The operation searches for groups of duplicate overlapping regions and removes all but one of the regions in each group.



Arguments
NameDescription
remove This parameter specifies which "similar" regions to prune from the dataset.
  • duplicates: Removes regions that are identical copies of another region in the track so that only one copy of each region remains
  • similar: Removes regions that are have the same type and location (including orientation) as another region in the track. Only the region with the highest score is retained (v2.0.-2).
  • palindromes: Searches for pairs of palindromic motif occurrences (two overlapping regions for the same motif on opposite strands) and removes one of these.
  • alternatives: Searches for overlapping regions for motifs that are considered to be 'alternatives' of each other (either according to annotations in the motifs themselves or based on clustering in a Motif Partition) and prunes the overlapping regions so that only one remains. Note that two alternative overlapping regions are only considered to be duplicates of each other if they occur at an optimal alignment relative to each other.
keep This parameter applies when the "remove" parameter is either "palindromes" or "alternatives" and dictates which of the regions to retain and which to remove.

For "palindromes" this parameter can have one of the following values:
  • top scoring: Keep the region with the highest score and remove the other
  • direct strand: Keep the region that is located on the direct strand (genomic orientation) and remove the one on the other strand
  • relative strand: Keep the region that has the same orientation as the sequence and remove the region on the opposite strand

For "alternatives" this parameter can have one of the following values:
  • top scoring: Keep the region with the highest score and remove the others
  • highest IC: Keep the region corresponding to the motif with the highest information content
  • first sorted name: Keep the region with the motif name which occurs first in the list when the names of the motifs for the overlapping regions are sorted alphabetically
partition If the "remove" mode is "alternatives" this parameter can be used to specify a Motif Partition that decides which motifs are to be considered alternatives of each other (i.e. motifs in the same cluster). If this parameter is left unspecified, the definition of alternative motifs will be taken from annotations in the motif data objects themselves (as seen in the "Alternatives" tab in Motif dialogs).

Examples:

# Removes identical duplicate regions in the TFBS track so that only one copy of each region remains
prune TFBS remove "duplicates"

# Finds pairs of palindromic motif occurrences in the TFBS track (where two occurrences of the same motif are found overlapping each other but on different strands) and removes the one that has the lowest score of each pair
prune TFBS remove "palindromes" keep "top scoring"

# Finds overlapping regions in the TFBS track for motifs that are annotated as alternatives of each other and removes all the duplicates so that only the region corresponding to the motif with the highest information content remains
prune TFBS remove "alternatives" keep "highest IC"

# Finds overlapping regions in the TFBS track for motifs that are in the same cluster in the Motif Partition named 'AlternativePartition' and removes all the duplicates so that only the region with the highest score remains
prune TFBS remove "alternatives" from AlternativePartition keep "top scoring"




rank

The "rank" operation will return a new Numeric Map where the values correspond to the rank order of the entries in another Numeric Map, a similar numeric column from an Analysis, or internal numeric properties of data objects. The rank order can also be based on a weighted combination of several such properties. In that case, each property is first ranked on its own and the rank-values are multiplied by the weight for that property (if specified). The ranks are then summed up across all properties and a final rank order is derived from these values (in ascending order). (Note that the entries are not ranked first by the first value, and then by the second value to break ties etc.) Entries that have the same value will receive the same rank. For example, a map with entries "A=3,B=5,C=2,D=13" will be ranked (ascending) as "A=2,B=3,C=1,D=4", and a map with entries "A=3,B=3,C=2,D=13" will be ranked (ascending) as "A=2,B=2,C=1,D=4" (Note that D is still ranked as number 4 and "rank 3" has been skipped).



Arguments
NameDescription
sort direction "ascending" (default) or "descending". Controls how the values for the property should be sorted before determining the rank.
property The "property" argument specifies which values to use from the source object. If the source is a Numeric Map, this argument is not applicable since only the Map values can be used. If the source is an Analysis object, this argument should specify which numeric column to use from the Analysis. If the source is the type of a data object ("Motif","Module" or "Sequence"), this argument should specify which internal numeric property to use.
value Specifies how each property should be weighted if there are more than one. If no weights are specified, each property will be weighted equally (the default weight is 1.0). Note that a higher weight will punish the property, since the ranks for that property will be multiplied by the weights and lower values are considered better. More important properties should therefore be given lower weights than less important properties.

Examples:

# Returns a Motif Numeric Map where the value for each motif corresponds to its rank when the map is sorted in ascending order
rank Motif_IC_map

# Returns a Motif Numeric Map where the motifs are ranked by descending size
rank descending "size" from Motif

# Returns a Motif Numeric Map where the motifs are ranked by a weighted combination of three properties, the p-value for a motif overrepresentation analysis, the average value of a Numeric track inside the motif region across all binding sites and the kurtosis of the motif position distribution across all sequences. The first property is considered more important for the final rank than the last two.
rank ascending "p-value" from MotifOccurrenceAnalysis, descending "average" from CompareMotifsToNumericTrackAnalysis with weigth=2.0, descending "Kurtosis" from MotifPositionDistributionAnalysis with weight=2.0




replace

The "replace" operation (v2.0) replaces portions of text in a Text Variable or a textual property of a Region Dataset. The basic mode of this operation will search the body of text for a specified search term (which can be in the form of a regular expression) and replace all instances matching this search term with a given replacement text (which can contain backreferences to capture groups in the search expression).

The operation can also be used to search Text Variables for instances of macro names and replace these with their corresponding definitions ("replace macro") or to add new lines to the beginning or end of a Text Variable ("replace beginning/end").



Arguments
NameDescription
search expression This parameter specifies the text expression(s) to search for in the source object. Any matching instances of this expression will be replaced with the text provided by the "replacement expression" parameter. The parameter can either be a simple literal search term or it can take the form of a regular expression defining a more complex search pattern. Regular expressions should follow the syntax used by the JAVA programming language as described below. The search expression can also be provided in the form of a Text Variable or Map. If the search expression is a Text Variable, the "replacement expression" parameter must also be a Text Variable with the same number of lines. The two Text Variables then function somewhat like maps and portions of text that match the expression at line n in the first Text Variable will be replaced by the corresponding replacement expression at line n in the second Text Variable (or if you have a single Text Variable with two columns you can use this same Text Variable as both search and replacement expression and MotifLab will automatically use the first column as search expression and the second as replacement). Using Text Variables to specify search/replacement expressions allows you to search for multiple expressions at the same time. If the source data object is also a Text Variable each line of the text will be transformed by applying every search expression in turn, but if the source is a Region Dataset only the first matching search expression will be used for each region. If the search expression is a Map, the replacement expression parameter need not be defined as this will be based on the corresponding map values. If the source data object is a Text Variable, each line of the text will be transformed by replacing every instance of each key from the map with its corresponding map value (the entries will be processed in random order). If the source object is a Region Dataset, the current value of the specified property will be used as a key to retrieve the corresponding value from the map and the property value will then be replaced with the new value from the map.

Regular expressions:

Some commonly used regular expression rules include:
  • A vertical bar can be used to separate alternative matching expressions
  • Parentheses can be used to group character togethers
  • A dot "." matches any single character
  • A "+" plus sign after a character or group means that this character/group should match one or more times
  • A "*" star sign after a character or group means that this character/group should match zero or more times
  • A "?" sign after a character or group means that this character/group should match zero or one times (i.e. it is optional)
  • Two numbers in braces "{n,m}" directly behind a character or group means that the character/group should match between n and m times
  • A character class can be defined by listing characters in brackets and will match any single character in the class. E.g. the class "[abc]" will match either a, b or c
  • You can negate a character class by placing a "^" directly after the first bracket. E.g. the character class "[^abc]" will match any single character besides a, b and c
  • The special character class denoted by "\d" will match a single digit character and the complementary class "\D" will match a single non-digit character
  • The special character class denoted by "\w" will match a single "word" character (digit, letter or underscore) and the complementary class "\W" will match a single non-word character
  • The special character class denoted by "\s" will match a single whitespace character and the complementary class "\S" will match a single non-whitespace character
  • The following characters have special meaning within regular expressions and must be escaped with a backslash in front if you want to refer to them in a literal sense: \.+*[]{}()?^$|
For more information about the syntax of regular expressions in JAVA, consult this tutorial (or this one).

Examples:
The expression "cat|dogs?" will match either cat, dog or dogs.
The expression "b[aie]ts" will match either bats, bits or bets.
The expression "Go{2,5}gle" will match either Google, Gooogle, Goooogle or Gooooogle.
The expression "M.\d+" will match any word beginning with "M" followed by any character and then a succession of digits.
The expression "Hip(hop)+opotamus" will match words beginning with "Hip", followed by "hop" repeated any number of times and then ending with "opotamus".
replacement expression This parameter defines the text that should replace matching instances of the search expression in the source object. If the search expression is in the form of a regular expression containing "capture groups" (groups of character within parentheses), the replacement expression can contain backreferences to these capture groups on the form "$n" where n is the number of a capture group.

Example:
Consider the search expression "([A-Z])\$(\S+?)(_\w+)?" that will match an uppercase letter followed by a dollar sign, a number of non-whitespace characters and optionally ending with a suffix consisting of an underscore followed by numbers or letters. This expression contains three capture groups: the first capturing the single uppercase letter at the beginning, the second capturing the middle part following the dollar sign and the last capturing the suffix starting with the underscore. If the replacement expression is given as "$2:$1", all matching instances of the search expression will be replaced by a new text consisting of the middle part of the matching text followed by a colon and then the beginning uppercase letter. Hence, the match "V$VMYB_01" will be replaced with "VMYB:V" and the match "F$ABF_C" will be replaced with "ABF:F".
property If the source data object is a Region Dataset, this parameter specifies the textual property of regions that will be affected by the operation. If left unspecified, it defaults to the "type" property.

Conditions: region condition

Examples:

# Replaces all instances of “cats” in TextVariable1 with “dogs” and stores the result in TextVariable2
TextVariable2 = replace "cats" with "dogs" in TextVariable1

# For RepeatMasker regions whose type property matches “Alu” followed by a suffix, the operation will place the suffix at the beginning instead
replace "Alu(.+)" with "$1Alu" in RepeatMasker property "type"

# Goes through every RepeatMasker region and looks up its type property in the NameMap map. Then it replaces the type of the region with the corresponding value from the map
replace NameMap in RepeatMasker property "type"

# Replaces all instances of recognized macro names in TextVariable1 with their corresponding macro definitions
replace macros in TextVariable1

# Adds a line of text to the beginning of TextVariable1. (It does not actually replace any existing text)
replace beginning with "new header text" in TextVariable1

# Adds a line of text to the end of TextVariable1. (It does not actually replace any existing text)
replace end with "new footer text" in TextVariable1




score

The "score" operation uses a basic motif scanning algorithm to compare a single motif model (or a collection of motifs) against a DNA sequence, but rather than returning a track containing matching regions, the operation returns a numeric track with the motif match score for each position. If the operation is used with a collection of motifs rather than a single motif, all the motifs in the collection will be scanned against the DNA sequence and the highest match score obtained for each position will be returned.



Arguments
NameDescription
motif A single motif or collection of motifs to scan against the DNA sequence
normalization mode This parameter can either be "absolute" which means that the unnormalized match scores are returned or "relative" which will return match values between 0 (worst match) and 1 (best match) based on the lowest and highest achievable match scores according to the motif model.
score mode If this parameter is set to "raw" the match score will be calculated by summing up the relative frequency values from the motif matrix for the matching base in each position. However, if the score mode is set to "log-likelihood" the frequency of the matching base according to the motif matrix will be compared (using log-likelihood) against the expected frequency of that base according to a chosen (zero order) background model.
strand This parameter controls which strand of the DNA sequence to scan. Valid options are "direct" (genomic direct strand), "reverse" (genomic reverse strand), "relative" (strand corresponding to the orientation of the sequence), "opposite" (strand opposite of the sequence orientation) and "both". If "both" strands are considered, the motif will be matched against the sequence in both orientations at every position and the resulting score for each position will be based on the highest scoring orientation.
background If the "score mode" parameter is set to "log-likelihood" the frequency of a base in a position according to the motif model will be compared against the expected frequency according to the chosen background model. Note that only a zero-order model is used, even if the chosen background model might be of higher order. If no explicit background model is specified, a uniform model will be used.

Conditions: position condition

Examples:

# Scans the motif M00014 against the DNA sequence on the relative strand and returns a match score value between 0 and 1.0 for each position based on the motifs match against the sequence
scoreTrack = score DNA with M00014 using relative raw scores on relative strand


See also: motifScanning


search

This operation can be used to search DNA sequences for occurrences of a given DNA sequence pattern (or multiple patterns), specified as either regular expressions (in JAVA syntax) or as IUPAC consensus patterns. The search pattern can be a literal string enclosed in double quotes or the name of a Text Variable, single Motif or a Motif Collection (without quotes). When searching for a Motif or Motif Collection, the operation will search for the "consensus sequence" representation of the Motif (or all the motifs in the collection). The operation can also be used to search for occurrences of tandem or inverted repeats (two identical DNA patterns that occur close to each other in the DNA sequence). Constraints can be placed on the size of the two halfsites and the size of the gap between them.



Arguments
NameDescription
search expression The DNA expression to search for. This can either be a literal expression enclosed in double quotes or the name of a Text Variable, a Motif or a Motif Collection. A literal expression can be a regular expression (in JAVA syntax), an IUPAC consensus sequence or just a plain DNA sequence. If the expression is the name of a Motif or Motif Collection, the search expression used will be the IUPAC consensus string for the motif (or for all motifs in the collection). If the expression is the name of a Text Variable, the search operation will search for all expressions listed in the Text Variable in turn (multiple expression can be specified with one on each line).
repeat type The type of repeat to search for (when searching for repeats). This can be either "direct" (tandem repeats on the same strand) or "inverted" (the two halfsites should have opposite orientations).
halfsite size The size range to consider for the two halfsites when searching for tandem or inverted repeats. Specified as [min size, max size].
gap size The size range to consider for the gap between the two halfsites when searching for tandem or inverted repeats. Specified as [min size, max size].
report Controls how to define and return a "match" region when searching for tandem or inverted repeats. The allowed values for this setting is "halfsites" or "full". If "report full" is chosen, each match to a tandem or inverted repeat will return a single region covering both halfsites as well as the gap between them. If "report halfsites" is chosen, each match to a tandem or inverted repeat will return two regions (one for each halfsite).
strand orientation Specifies which strand(s) of the sequence to search for the pattern in. This could be either "both strands", "direct strand" (relative to genomic orientation), "reverse strand" (relative to genomic orientation), "relative strand" (the same orientation as the sequence), or "opposite strand" (the strand opposite to the orientation of the sequence)". The strand orientation setting is only applicable when searching for given expressions, not when searching for tandem/inverted repeats.
mismatches The maximum number of positions that are allowed to deviate from the search pattern before a sequence region is no longer considered a match. Mismatches are not allowed for regular expression search patterns, only for constant expressions. For example: if no mismatches are allowed, the search pattern "CAG" will match only "CAG". With one mismatch allowed, "CAG" will match "CAG" but also "AAG,GAG,TAG,CCG,CGG,CTG,CAA,CAC and CAT".

Examples:

# Searches the DNA sequence for the pattern 'CACGTG' on both strands and returns a track containing the matching regions
search DNA for "CACGTG"

# Searches the DNA sequence for the patterns 'CAC' and 'GTG separated by 2 to 3 arbitrary nucleotides on the direct strand
search DNA on direct strand for "CACn{2,3}GTG"

# Searches the DNA sequences for matches to all motifs in the collection. Each reported binding site is allowed to deviate from the motif consensus in up to two position
search DNA for TRANSFAC_Public with 2 mismatches

# Searches the DNA sequences for inverted repeats separated by 1 to 5 bases. Each half site should be between 4 to 7 bases long and the returned track will contain these halfsites
search DNA for inverted repeats {halfsite=[4,7], gap=[1,5], report=halfsites}


See also: motifScanning


set

The "set" operation is an assignment operator which can be used to set the value of a numeric data object to a new specified value. For Numeric Datasets the operation will be applied to all positions in the sequences, and for Numeric Maps it will be applied to all entries in the map (including the "default" value). The operation can also be applied to Region Datasets to set the value of numeric properties or text properties. By default the operation will be applied to the "score" property of the regions unless a different property is specified.



Arguments
NameDescription
property Specifies which property of the data object to assign the value to. For Numeric Datasets, Numeric Maps and Numeric Variables this will simply be the "value", but for Region Datasets you can select which property of the regions to assign to (the default is "score"). Note that user-defined region properties will not be shown in the drop-down list in the operation dialog, but it is still possible to type in the name other properties.
value Specifies the new value for the assignment. If the value is a literal number or a Numeric Variable, each potential value in the source object will be set to this same value. If the source object is a Numeric Dataset and the "value" is also a Numeric Dataset, the value of each position in the source will be set to the value in the same position in the "value" dataset. If the source is a Numeric Dataset and the "value" is a Sequence Numeric Map, the values of all positions in each sequence are set to the value for that sequence in the map (so each sequence is potentially assigned different values). If both the source and "value" are Numeric Maps of the same type, the entries in the source map will be set to the corresponding values in the "value" map. If the source is a Region Dataset and the "value" is a Numeric Dataset, the region property can be set to a value derived from the values in the Numeric Dataset which are covered by the region. This value could be e.g. the minimum, maximum, average, median or sum of all values within the region or it could be the value of a single position at the center, start or end of the region ("start" and "end" refers to the lowest and highest genomic coordinates of the region with respect to the direct strand. The "relativeStart" and "relativeEnd" positions refer to the most upstream and most downstream position in the region when viewed relative to the orientation of the sequence, and the "regionStart" and "regionEnd" values refer to the most upstream and most downstream positions relative to the orientation of the region itself). If the region is a "motif" region, it is also possible to use "weighted average" or "weighted sum" where the values in each position are weighted by the information content of the motif in the corresponding position. If the operation is applied to a "text" property of a Region Dataset, the "value" should either be a literal string enclosed in parentheses or a Text Variable. The text property will then be set to the provided text (multiple values will be comma separated).

Conditions: position condition or region condition

Examples:

# Assigns the data object X the value 10. If X is a Numeric Dataset/Numeric Map/Region Dataset, all positions/entries/regions in the data object will be set to 10.
set X to 10

# Returns a new track where each position contains the highest value in that position between the two tracks
newNumericTrack = set Track1 to Track2 where Track2 > Track1

# Copies the contents of Map2 into Map2
set Map1 to Map2

# Sets the 'score' property of each region in the track to the average value of the NumericTrack within the region
set RegionTrack[score] to average NumericTrack

# Assigns the value 'one,two,three' to the text-property 'numbers' for all regions in the track
set RegionTrack[numbers] to "one,two,three"


See also: increase, decrease, multiply, divide


split_sequences

This operation (introduced in MotifLab v2) can take an existing set of sequences and derive a new set of sequences based on subsegments of the originals. The original sequences can be kept together with the new sequences or optionally be deleted. The subsegments on which to base the new sequences are taken from the locations of regions in a specified region track. Each region in this track will give rise to one new sequence, so if two regions are overlapping they will result in two overlapping sequences. The new sequences will have names on the form "XXX_n" where XXX is the name of the original sequence and n is an incremental number starting at 1 for each original sequence.

Note that the new sequences are not allowed to extend beyond the edges of the original sequences even if the regions they are based on do that.
For example, if you have a sequence spanning the [-1000,+200] region around the TSS of a gene which is 2000bp long (thus extending 1800bp further downstream of the original sequence) and you use split_sequences to create new sequences based on the gene annotation track, the new sequence location will be the intersection of the old sequence and the gene region, meaning the new sequence will correspond to the 200bp region starting at the gene TSS and extending downstream to the end of the original sequence. The gene region is kept at its original length, however, and is allowed to extend past the edge also in the new sequence.

The operation will return a sequence partition object where each newly created sequence is assigned to a cluster named after the original sequence it was based on. Old sequences not created by split_sequences will not be assigned to any cluster in the partition.

The result of applying split_sequences is usually some form of cropping of the original sequences (and also all associated feature tracks) so in some ways it is similar to the crop_sequences operation. The difference between this operation and crop_sequences is that the latter only modifies the original sequences whereas split_sequences creates new sequences. If your sequences contain exactly one region each, the result of the two operations will be (almost) the same. However, if you have a sequence containing two regions, crop_sequences will crop the original sequence so that it begins at the start of the first region and ends at the end of the second region, whereas split_sequences will create two new sequences where each is cropped to match one of the regions in the original sequence.

The split_sequences operation is the only exception to the rule that new sequences cannot be created after feature datasets have been added. The reason for having this rule is that the feature tracks would normally be undefined within the new sequences. However, since the sequences created by split_sequences are based on subsegments of existing sequences, all the necessary feature data for the new sequences will already be present.



Arguments
NameDescription
Region track This argument specifies the track whose regions the new sequences shall be based on
Delete original sequences If this flag is set, the set of newly created sequences will totally replace the old sequence set. If not set, the original sequences will be be kept and the new sequences will just be added to the current set.

Examples:

# Creates a new set of sequences based on gene regions from the EnsemblGenes annotation track. The original sequences are kept, so the new sequences are added to the current set
SequencePartition1 = split_sequences based on EnsemblGenes

# Creates a totally new set of sequences where each sequence correponds to a single binding site in the TFBS track. The original sequences are discarded.
SequencePartition2 = split_sequences based on TFBS. Delete original sequences




statistic

Calculates a statistic for each sequence in a dataset and returns a Sequence Numeric Map containing the results for each sequence.



Arguments
NameDescription
function The statistic function to be calculated. The type of statistics available depend on the input data track.
  1. DNA Sequence Dataset statistics
    1. GC-content: The GC-content of the sequence
    2. A-count: The number of 'A' bases in the sequence
    3. C-count: The number of 'C' bases in the sequence
    4. G-count: The number of 'G' bases in the sequence
    5. T-count: The number of 'T' bases in the sequence
    6. A-frequency: The number of 'A' bases in the sequence divided by the total number of positions (matching the current condition)
    7. C-frequency: The number of 'C' bases in the sequence divided by the total number of positions (matching the current condition)
    8. G-frequency: The number of 'G' bases in the sequence divided by the total number of positions (matching the current condition)
    9. T-frequency: The number of 'T' bases in the sequence divided by the total number of positions (matching the current condition)
    10. Unknown-count: The number of unknown bases in the sequence (not A, C, G or T)
    11. Unknown-frequency: The number of unknown bases in the sequence (not A, C, G or T) divided by the total number of positions (matching the current condition)
    12. base count: the total number of bases in the sequence (matching the current condition)
  2. Numeric Dataset statistics
    1. Minimum value: the lowest value in the sequence
    2. Maximum value: the highest value in the sequence
    3. Extreme value: the value with the largest magnitude (absolute value) in the sequence (added in MotifLab v2).
    4. Average value: the average value across all positions in the sequence
    5. Sum values: the total sum of all values across all positions in the sequence
    6. base count: the total number of bases in the sequence (matching the current condition)
  3. Region Dataset statistics
    1. Minimum score: The score of the region that has the lowest score in the sequence
    2. Maximum score: The score of the region that has the highest score in the sequence
    3. Extreme score: The score of the region that has the highest absolute value in the sequence (added in MotifLab v2).
    4. Average score: The average score across all regions in the sequence
    5. Average score: The average score across all regions in the sequence
    6. Sum scores: The total sum of scores across all regions in the sequence
    7. Region count: The number of regions in the sequence
    8. Region base count: The number of bases in the sequence that are covered by regions.
      Note that this number can be smaller than the sum of the region lengths if regions are overlapping, since each base position is only counted once.
strand orientation Specifies which strand the statistic should be applied to for DNA Sequence Datasets. This could be either "direct strand" (relative to genomic orientation), "reverse strand" (relative to genomic orientation), "relative strand" (the same orientation as the sequence), or "opposite strand" (the strand opposite to the orientation of the sequence)".

Conditions: position condition, region condition or subset condition

Examples:

# Returns the highest value within the 'Conservation' track for each sequence
statistic "maximum value" in Conservation

# Returns the number of regions in each sequence of the track
statistic "region count" in TFBS

# Returns the number of bases within known repeat regions in each sequence
statistic "region base count" in RepeatMasker

# Returns the GC-content inside the CpG-islands in each sequence
statistic "GC-content" in DNA where inside CpG-islands




threshold

Assigns all numeric values in a data object that are equal to or above a specified cutoff threshold a new value and those below the cutoff a different value. For Numeric Datasets the operation will be applied to every position in all sequences, for Region Datasets the operation will be applied to the score-property of every region, and for Numeric Maps and Expression Profiles the operation will be applied to every value in the Map/Profile.



Arguments
NameDescription
cutoff The cutoff threshold which will divide all numeric values in the source object into two groups: those equal to or above the cutoff and those below the cutoff. The value can be specified as a numeric constant, a Numeric Variable or Sequence Numeric Map (if applicable). It is also possible to specify a relative threshold value by appending a percentage sign after the cutoff (number or data object name). In this case the cutoff value should be between 0 and 100 (if a relative cutoff is outside this range it will be set to either 0 or 100). For example, the cutoff "50%" (or equivalently "50%C") will use a cutoff which is halfway between the smallest and largest values found in the source object (considering only sequences from the specified sub-collection). By appending "%D" instead of "%C" the value range used to derive the relative cutoff is based on all sequences (not just the specified collection). For feature datasets, it is possible to use different relative thresholds for each sequence by appending "%S". E.g. the cutoff "50%S" will for each sequence use a cutoff which is halfway between the smallest and largest values found in that sequence (unlike "%C" or "%D" which will use the smallest and largest values among sequences in the chosen collection or all the sequences respectively).
Note: The "%C" operator was added in version 2.0 of MotifLab and at the same time the behaviour of the "%" operator was changed to be equal to "%C" rather than "%D". This is intuitive, since if the threshold operation is applied to a (sub)collection of sequences, only the sequences within that collection would be considered when the relative cutoff-threshold is calculated. (If no particular collection is specified, the "%C" and "%D" operators will behave the same).
above All entries in the source data object that have values above or equal to the specified cutoff threshold will be assigned a new value which is specified with this parameter. This value can be a constant number, a Numeric Variable, a compatible Numeric Map or one of the six "special values": sequence.min, sequence.max, dataset.min, dataset.max, collection.min, collection.max. The "sequence.min" and "sequence.max" values are respectively the smallest and largest values within each sequence (applicable to Numeric Datasets and Region Datasets), the "dataset.min" and "dataset.max" values are the smallest and largest values found in the source data object, and if the operation is limited to a collection, the "collection.min" and "collection.max" values will be the smallest and largest data values in the source object among all the members in the collection.
below Similar to the "above" parameter. Entries that have values below the specified cutoff will be assigned the "below" value.

Conditions: position condition or region condition

Examples:

# Sets all positions in the Conservation track that have values above or equal to 0.3 to the new value 1.0 and those below 0.3 to the new value 0.0
threshold Conservation with cutoff=0.3 above=1 below=0

# Finds the value which is halfway between the smallest and largest values of the Conservation track within each sequence and sets those positions that have value equal to or above this halfway value to 1.0 and those below to 0.0
threshold Conservation with cutoff=50%S above=1 below=0

# Sets all positions in the Conservation track that have values above or equal to 0.3 to the highest value in the entire dataset and those with value below 0.3 are set to the smallest value in the entire dataset
threshold Conservation with cutoff=0.3 above=dataset.max below=dataset.min

# Version 2.0 of MotifLab introduced a more natural command syntax
threshold Conservation with cutoff=0.3 set values above cutoff to dataset.max and values below cutoff to dataset.min




transform

Transforms each numeric value in a data object according to a selected mathematical function. For Region Datasets the transform will be applied to the 'score' properties of the regions unless a different numeric property is specified. A few special transforms that target Region Datasets may also modify non-numeric values ("reverse" and "type-replace"). Note that values which can not be transformed for some reason will just be skipped (e.g. when taking the logarithm of negative values or dividing by zero). Usually, a warning message will be provided in the log when this occurs.



Arguments
NameDescription
function Decides which mathematical transform function to apply to each numeric value 'X' in the original data object. The available functions are:
  • "absolute" : returns the absolute value of X
  • "ceil" : returns the smallest integer number equal to or larger than X
  • "cubic-root" : returns the cubic root of X
  • "floor" : returns the highest integer number equal to or smaller than X
  • "gaussian" : returns a random real number drawn from a Gaussian distribution with mean 0.0 and standard deviation 1.0
  • "log" : returns the natural logarithm of X
  • "logX" : returns the logarithm of X using a log-function with with base specified by the argument
  • "logit" : returns the "logit" of X, i.e. log(X/(1-X)) (natural logarithm)
  • "modulo" : returns the value X%argument
  • "odds" : returns the "odds" of the original value, i.e. X/(1-X)
  • "power" : returns the value X raised to the power of the argument
  • "random" : returns a random real number between zero (inclusive) and the argument value (exclusive)
  • "reciprocal" : returns the reciprocal of X, i.e. 1/X
  • "reverse" : This transform can be applied to Region Datasets to reverse the orientation of the regions (including their 'sequence' properties).
  • "round" : returns the integer value closest to X
  • "sigmoid" : returns the sigmoid function applied to X, i.e 1/(1-e^(-X))
  • "signum" : returns 0 if X 0, +1 if X is positive, and -1 if X is negative
  • "square-root" : returns the square root of the original value
  • "type-replace" : This transform can be applied to Region Datasets to replace the value of the 'type' property of regions (see further details below).
  • "wave" : returns the value of the function cos((2*pi*X/argument)). If this transform is applied to a numeric dataset where the values inside each sequence is increasing/decreasing linearly (for instance of the track is derived with the 'distance' operation), the result will be a regular cosine wave.
argument Some of the transform function might require and additional 'argument' to be specified.
  • "logX" : the argument is the base of the logarithm. E.g. an argument of "2" will return log2(X)
  • "power" : the argument is the power to which the original value X should be raised. E.g. an argument of "3" will return X^3
  • "random" : the argument is the maximum value for the returned random number (exclusive). E.g. an argument of "10" will return random numbers in the range [0,10)
  • "modulo" : the argument is the modulo operator. E.g. and argument of "10" will return X%10 for each original value X.
  • "wave" : the argument will determine the "width" of the wave.
  • "type-replace" : the argument should be a Text Variable where each line is on the format "oldexpression=>newtype". The transform operation will go through each region in the Region Dataset and if the type of a region matches the "oldexpression" (which can be in the form of a regular expression), the type will be replaced with "newtype".

Conditions: position condition or region condition

Examples:

# Returns a numeric track where positions with a conservation value lower than 0.5 is set to 0 and those value a value equal to or higher than 0.5 is set to 1
transform Conservation with round

# Returns a Motif Numeric Map where each entry (including the default value) is assigned a random value in the range [0,2). Note that only entries that had specifically assigned values in the original map will be transformed (the rest will default to the same new default value)
transform MotifNumericMap with random(2)


See also: distance


Protocols

A "protocol" is a document which describes a list of operations to be executed in order (including specifications of their parameters, conditions and constraints). Protocols can be used to document the steps you perform during an analysis session, and they can describe workflows that can be automatically executed by MotifLab. If you like, you can specify exactly which sequences to perform the analyses on in the protocol itself, and the protocol will then always perform the analysis on these squences. However, if the sequences are not explicitly specified, the protocol will just describe a generic analysis workflow which can be applied to any set of sequences (as long as any additional data needed by the protocol is available for the organism and genome build you apply the analysis to).

Creating a protocol

Protocols can either be written manually in the protocol editor (or an external text editor) or they can be made with MotifLab's record functionality which will automatically register all the operations you perform to the protocol.

To create a new protocol, press the "New Protocol" button in the toolbar or go to the "File" menu and select "New Protocol" from there. The protocol editor (described below) will then display the new protocol. You can also open a previously saved protocol by pressing the "Open Protocol" button in the toolbar or selecting "Open Protocol" under the "File" menu.

To activate the "record mode", simply press the round red record button in the toolbar (or select "Record" under the "Protocol" menu). Any operations you perform after activating record mode will be registered in the protocol. Note that the recorded protocol commands will be inserted at the location of the cursor in the editor and not appended to the end (unless the cursor is at the end of the protocol). This means that you can also use record mode to insert new commands anywhere in the protocol by first placing the cursor at a line and then performing a new operation. Press the stop button in the toolbar to deactivate record mode (or select "Stop" under the "Protocol" menu).

Executing a protocol

You can execute a protocol by pressing the "Execute" (play) button in the toolbar or selecting "Execute" from the "Protocol" menu. MotifLab will then go through all the operations that are described in the protocol. If the protocol contains operations that applies to sequences and no sequences are defined in the protocol itself, the protocol will be applied to the sequences that are currently known to MotifLab. If no sequences are known, MotifLab will display the Sequence Dialog and prompt the user to specify which sequences to perform the protocol on.

It is also possible to execute just a subset of the commands listed in the protocol. To execute a number of consecutive lines, select the lines that you want to run by marking the text in the protocol editor (you need not select the full line to include it, it is enough that just parts of a line is selected). Then go to the "Protocol" menu and select "Execute Current Selection". You can also execute only the line where the cursor is currently at by selecting "Execute Current Line" from the "Protocol" menu (NB: this might not work properly in version 1.000 due to a bug), or by holding down the CONTROL key while pressing ENTER inside the protocol editor (if you hold down the SHIFT key at the same time you will suppress any dialogs that might pop up to display the results of the operation).To stop the execution of a protocol before it is finished, just press the "Stop" button in the toolbar.

The protocol language

The standard protocol language employed by MotifLab was designed to be close to natural language so that it should be possible for a human user to read and understand a protocol script without being an experienced programmer. However, the protocol language also has a few constraints in order to make it easily processable by MotifLab. First, each line in the protocol can only contain one command and each command can not span more than one line. Second, the first word of a command (after the assignment operator "=") must be the name of an operation. Apart from that, each operation decides for itself how the command should be expressed. However, most operations rely on a command syntax which follows this general format:
   [target = ] <operation name> [arguments clause] [condition clause(s)]   

The target clause at the start of the line states a name for a new data object that is created by the operation. For many operations this target clause is optional and the target will then be the same as the source object. E.g. in the first example command line below, the value of X is increased by 10, since X is both the source object and the (implicit) target. The command in the second line, however, will create a new data object named Y which has a value equal to X+10, but the value of X itself will not be changed. Some operations return more than one data object and in such cases the target is specified as a vector with multiple comma-separated names enclosed in square brackets (as can be seen for the "plant" operation in the last example below).

The arguments clause specify values for different arguments used by the operation. This will almost always include the "source" data object that the operation should be applied to, but different operations may also require additional arguments to be specified. For example, when performing the "increase" operation on a Region Dataset, the operation also requires two additional arguments to be specified: one which tells the operation which property of the regions to increase the values of and another which tells the operation how much the current value of this property should be increased. Some operations have rather many arguments (or even a variable number of arguments) and these operations often rely on "argument maps" to specify values for some or all of their arguments in a more compact form. An argument map is simply a comma-separated list of "argumentName=argumentValue" pairs enclosed in curly braces. The two last example commands below make use of argument maps (operations "motifScanning" and "plant").

The condition clause is always optional but can be used to limit the application of the operation. Depending on the type of condition, this clause will either begin with "where" or "in collection".

In the following example commands the operation name is shown in red, the arguments clause in green, the condition clause in blue and the target clause in pink.
increase X by 10
Y = increase X by 10
multiply Conservation by 2 in collection UpregulatedSequences
filter BindingSites where region's average Conservation < 0.7
TFBS = motifScanning in DNA with SimpleScanner {Motif Collection=JasparCore,Threshold=95}
[ SequencesWithPlantedMotifs , PlantedSites ] = plant M00001 in DNA {Plant probability=0.8}


Comments
Lines in a protocol that start with a # sign will be treated as comments and ignored during execution. Note that all comments must be on their own lines since it is not possible to add comments at the end of other command lines.

Temporary data objects
Sometimes it will be necessary for a protocol script to create temporary data objects that are used for e.g. intermediate calculation steps but are not really interesting for the user after the execution of the protocol has ended. Such data objects can be given names starting with an underscore to mark them as temporary. Temporary data objects will not be displayed in any data panels or in the Visualization panel and they will be deleted immediately after the protocol execution ends.

Flow control

Protocols scripts in MotifLab are designed to be conceptually simple, where each line in the protocol from the first to the last should be executed once and only once in succession. The protocol language and commands to perform various operations are inspired by the paradigm of declarative programming, whereby a programmer describes what they want to achieve rather than micromanaging exactly how to go about to produce the desired outcome. For example, if an operation is applied to a data object that naturally contains subentries, MotifLab will implicitly perform the operation on each of these subentries in turn, as long as all imposed conditions hold true for the entry. Because of this (and also because MotifLab does not support constructs such as data arrays or reference variables), there is really little need for the protocol language to include flow-control statements such as loops and conditional blocks.

Nevertheless, from version 2.0 onwards, MotifLab does support limited flow-control in the form of conditional "if-then-else" statements.
The basic syntax for a conditional statement block is:
  if <condition>  
      ....
      ....
  end if 

You can have alternative "else if" condition blocks after the first "if", and the first block whose condition is satisfied will then be executed. An optional default "else" block will only be executed if none of the conditions for any of the previous "if" or "else if" blocks were satisfied. It is allowed to nest "if-else" statements to arbitrary levels.
  if <condition>  
      ....
  else if <condition>  
      ....
  else if <condition>  
      ....
  else
      ....
  end if

So far it is only possible in the condition expression to compare a single data object to another data object or literal value (textual or numeric).
However, multiple conditions can be connected with boolean operators "AND" and "OR" to create more complex compound conditions.

Conditions allowed in flow-control statements
Operand1ComparatorOperand2Condition holds true when...
Text VariableequalsTextthe text value of operand1 is exactly identical to operand2
Text Variable=Textthe value of operand1, when viewed as a set of strings, is the same as the set of strings in operand2
Text Variable<=Textthe set of strings in operand1 is the same as or a subset of the set of strings in operand2
Text Variable<Textthe set of strings in operand1 is a strict subset of the strings in operand2
Text Variable>=Textthe set of strings in operand1 is the same as or a superset of the set of strings in operand2
Text Variable>Textthe set of strings in operand1 is a strict superset of the strings in operand2
Text Variable<>Textthe set of strings in operand1 is not the same as the set of strings in operand2 (but they can still overlap)
Numeric Variable=Numericthe numeric value of operand1 is the same as that of operand2
Numeric Variable<=Numericthe numeric value of operand1 is less than or equal to the value of operand2
Numeric Variable<Numericthe numeric value of operand1 is strictly less than the value of operand2
Numeric Variable>=Numericthe numeric value of operand1 is greater than or equal to the value of operand2
Numeric Variable>Numericthe numeric value of operand1 is strictly greater than the value of operand2
Numeric Variable<>Numericthe numeric value of operand1 is different from the value of operand2
Collection=Collectionthe entries in operand1 are the same as the entries in operand2
Collection<=Collectionthe entries in operand1 are the same as or a subset of the entries in operand2
Collection<Collectionthe entries in operand1 are a strict subset of the entries in operand2
Collection>=Collectionthe entries in operand1 are the same as or a superset of the entries in operand2
Collection>Collectionthe entries in operand1 are a strict superset of the entries in operand2
Collection<>Collectionthe two collections are not the same (but they can still overlap)
CollectionoverlapsCollectionthe two collections have at least one entry in common
Data=Datathe two data objects have the "same" value
Data<>Datathe two data objects do not have the "same" value

When Operand2 is "Text" the operand can either be a Text Variable, a Text Map (in which case only the default value is considered), a Collection or a literal text enclosed in double quotes. When the "equals" comparator is used, the two bodies of text must represent identical documents, but for the other comparators the bodies of texts are considered as "sets of strings" and the order of the strings is not important. For example, if T1 is "apples,oranges" and T2 is "oranges,apples" then "T1 equals T2" is false but "T1 = T2" is true.

When Operand2 is "Numeric" the operand can either be a Numeric Variable, a Numeric Map (in which case only the default value is considered), or a literal number.

For data objects that are not Text Variables, Numeric Variables, or Collections, only the two comparators "=" and "<>" are available to determine if the objects represent the same value or not (the definition of representing the "same" value depends on the data type).



Example: When the protocol below is executed, the user will be asked interactively for which motif scanner to use to predict binding sites (via the prompt command). Depending on the choice of algorithm, which can be either "MATCH" or "SimpleScanner", only one of the two motifScanning commands will be performed and return a BindingSites track.
DNA = new DNA Sequence Dataset(DataTrack:DNA)
Jaspar_Core = new Motif Collection(Collection:Jaspar Core)
Cutoff = new Numeric Variable(0.9)

Algorithm = new Text Variable("MATCH")
prompt Algorithm "Please select which motif scanning algorithm to use" {"MATCH","SimpleScanner"}L

if Algorithm = "MATCH"
   BindingSites = motifScanning in DNA with MATCH {Motif collection=Jaspar_Core,Matrix threshold=Cutoff}
else if Algorithm = "SimpleScanner"
   BindingSites = motifScanning in DNA with SimpleScanner {Motif Collection=Jaspar_Core,Threshold=Cutoff}
else
   !message("Unknown motif scanning algorithm: {Algorithm}")=ERROR
end if


The protocol editor

The protocol editor can be found under the "Protocol" tab in the main panel.


The protocol editor consists of three panels. On the top is a blue header panel which displays the name of the protocol. New protocols are given default names like "Protocol-1", "Protocol-2" etc., but you can change the name by saving the protocol to a file (by going to the "File" menu and selecting "Save" or "Save As..."). The protocol will then be given the same name as the file that you saved it to (minus the file-suffix). A protocol which has not been saved yet (or has been changed since it was last saved) will have an asterisk after the protocol name in the header. It is possible to have multiple protocols open at the same time in MotifLab, and you can then switch between them via a drop-down menu which is available by pressing the down-arrow button on the right side of the header (or by going to the "Protocol" menu and selecting "Change Protocol"). Only the protocol which is currently displayed in the protocol editor will be "active", however.

The main part of the protocol editor is the editor panel itself. Here the currently selected protocol is displayed and can be edited. Each operation command must be written out on a single line in the protocol in order for MotifLab to understand it correctly. (Word wrapping functionality for long lines will hopefully be included in a future version of MotifLab).
The protocol editor can use colors to highlight keywords of different types in the protocol. According to the default color scheme, the names of operations are colored RED, names of specific data objects are colored BLUE, general data types are in ORANGE (as are names of analyses and names of general data formats for input and output), names of external programs are in GREEN, literal numeric constants are in PINK and literal text constants (in double quotes) are in GREEN, display settings are in CYAN and comments are in GRAY. If you don't like these default colors you can change them by selecting "Options..." from the "Configure" menu and go to the "Protocol Editor" tab in the Options-dialog which pops up.

The editor panel has a gray margin area to the left which displays line numbers in front of each protocol line and sometimes also small icons in front of these line numbers. These icons have the following interpretations:
This protocol line contains an error. Point the mouse at the icon to display the error message.
MotifLab is currently executing the operation on this line.
The operation on this line was successfully executed.
The protocol execution was stopped by the user on this line.
The execution of the protocol was aborted at this line due to an error.
Point the mouse at the icon to display the error message.

At the bottom of the protocol editor is the status panel with three boxes followed by a status message line. The first box contains a "status light" which can either be colored green, yellow or red (or black when there are no protocols). A green light means that the protocol does not contain any errors as far as MotifLab can tell, and it should therefore be possible to execute it. A red light means that the protocol contains errors which makes it impossible for MotifLab to parse it correctly. The number of errors detected in the protocol will be displayed int the status message line, and the lines that contain these errors should also be marked with error icons in the margin. (To see what is wrong with a line, point the mouse at the error icon to see the error message). If you try to execute a protocol containing errors, MotifLab will refuse and display an error message. If the status light has a yellow color this indicates that MotifLab has yet to determine whether the protocol contains any errors or not. This color is usually displayed if you start typing into the protocol. MotifLab will then wait until you have stopped typing before it checks the protocol for errors and then changes the light to either green or red.

The second box on the status line (after the status light) displays the coordinates of the cursor in the format "line:column", and the third box shows if the editor is currently in "insert mode" (INS) or "overwrite mode" (OVR). If the editor is in "insert mode", newly typed characters will be inserted at the position of the cursor and any text that follows the cursor will pushed forward. If the editor is in "overwrite mode", however, any character currently under the cursor will be replaced by a newly typed character. You can toggle between the two modes by pressing the INSERT key on your keyboard (if you have one).

Display settings

When MotifsLab's "record mode" is activated to log a users actions in a protocol, only the operations that the user executes are recorded. Other activities the user performs, such as for instance changing the color or height of a data track, are not recorded. However, it is possible to include such visual cues in the protocol as well, by manually entering display setting statements. A display setting statement starts with a dollar sign '$' (or alternatively an exclamation mark '!') at the beginning of the protocol line and is immediately followed by the name of the setting to be specified.
The general format is:
$setting(target)=value

Note that both the setting and the value are normally case-insensitive but the target is case-sensitive. The difference between using a dollar sign in front of the statement and an exclamation mark, is that when the dollar sign is used, the system will check that the target data objects exist and have the correct type. If an exclamation mark is used instead, the system will not perform any checks but just make a record of the setting for future reference. Hence, using the exclamation signs allows you to set display settings for data objects that have not been created yet.
A table describing all recognized display settings is provided below. The target argument specifies which data object(s) the setting should be applied to. A target can for instance be the name of a feature track, a sequence, a motif or a module depending on the display setting. A comma-separated list of targets can be specified instead of just a single target, and if the setting applies to sequences, motifs or modules, names of collections of such objects can also be used. Alternatively, instead of naming specific targets, a single wildcard (*) can be used to refer to all data objects of the applicable type. For settings that target "region types", a list of types can be provided or a special wildcard that target all region types found in a given Region Dataset like this "datasetname:*". Note that some settings do not have specific targets, in which case the target argument should be left blank.

The allowed values for each display setting are also specified in the following table. Some settings require the value to be a specific keyword (such as for the "graphtype" setting), while others require a numeric (usually integer) value or a boolean value (which can be specified as either TRUE/YES/ON, or FALSE/NO/OFF). The special color value can be entered as either a comma-separated triplet of numeric RGB-values in the range 0 to 255 (e.g.: "255,0,0" for RED or "255,255,0" for YELLOW), as a 6 digit hexadecimal number preceded by # (e.g. "#FF0000" for RED or "#FFFF00" for YELLOW) or using one of the following color-keywords: BLACK, BLUE, CYAN, DARK BROWN, GRAY, GREEN, LIGHT BLUE, LIGHT BROWN, LIGHT GRAY, LIGHT GREEN, MAGENTA, ORANGE, PINK, RED, VIOLET, WHITE or YELLOW. MotifLab v2.0 also allows the color to be specified with a colon-separated triplet of numeric HSB-values in the range 0.0-1.0.

In MotifLab v2.0, some of the fonts used (for instance to draw base letters in DNA tracks or tick labels in graphs) can also be changed. Fonts are specified as a comma-separated triplet defining the fontname, size and style. The fontname can either be one of the five logical fonts ("Serif", "SansSerif", "Monospaced", "Dialog" or "DialogInput") or the name of any font installed on the users computer. The size is an integer between 3 and 200 (recommended range between 8 and 30), and style can be chosen among the following options: "plain", "bold", "italic" or "bolditalic".
E.g.: $setting("system.dnaFont")=Serif,12,bold.

Setting Target Value Description
visibletracksbooleanSets the visibility of the specified tracks
showtracks Shows the specified tracks.
This is an abbreviation of: visible(x)=TRUE
hidetracks Hides the specified tracks.
This is an abbreviation of: visible(x)=FALSE
sequenceVisiblesequencesbooleanSets the visibility of the specified sequences
showSequencesequences Shows the specified sequences.
This is an abbreviation of: sequenceVisible(x)=TRUE
hideSequencesequences Hides the specified sequences.
This is an abbreviation of: sequenceVisible(x)=FALSE
regionVisibleregion typesbooleanSets the visibility of regions of the specified types
showRegionregion types Shows regions of the specified types.
This is an abbreviation of: regionVisible(x)=TRUE
hideRegionregion types Hides region of the specified types.
This is an abbreviation of: regionVisible(x)=FALSE
motifVisiblemotifsbooleanSets the visibility of the specified motifs
showMotifmotifs Shows the specified motifs.
This is an abbreviation of: motifVisible(x)=TRUE
hideMotifmotifs Hides the specified motifs.
This is an abbreviation of: motifVisible(x)=FALSE
moduleVisiblemodulesbooleanSets the visibility of the specified modules
showModulemodules Shows the specified modules.
This is an abbreviation of: moduleVisible(x)=TRUE
hideModulemodules Hides the specified modules.
This is an abbreviation of: moduleVisible(x)=FALSE
graph
graphtype
numeric tracksgraph
filled graph
line graph
outlined graph
gradient
heatmap
one-color heatmap
two-color heatmap
rainbow heatmap
Specifies which type of graph to use for the track
multicolorregion tracksbooleanSpecifies whether to draw all Regions in a Region track using the same color (FALSE)
or color the regions according to type (TRUE)
gradient
gradientfill
region tracksboolean
integer

off
vertical
horizontal
Specifies whether to draw boxes for Regions using a flat color fill or gradient fill. The keyword vertical, integer value 1 or boolean value TRUE, will set the fill to "vertical gradient fill".
The keyword horizontal or integer value 2 will set the fill to "horizontal gradient fill". Any other value will turn off gradient fill and just use plain flat colors.
showScoreregion tracksbooleanSpecifies whether to visualize the score of Regions by drawing the height of the Region boxes proportional to the score value
showOrientation
showStrand
region tracksbooleanSpecifies whether to visualize the orientation of Regions by drawing regions with same orientation as the sequence above the baseline and regions with opposite orientation below the baseline
color
foreground
fgColor
trackscolorSets the foreground color for the specified tracks
background
bgColor
trackscolorSets the background color for the specified tracks
secondary
secondaryColor
trackscolorSets the secondary color for the specified tracks
baseline
baselineColor
trackscolorSets the color of the baseline for the specified tracks
label
labelColor
sequencescolorSets the color of the labels for the specified sequences
canvas
canvasColor
 colorSets the background color of the visualization panel
regionColorregion typescolorSets the color for regions of the specified types
motifColormotifscolorSets the color for the specified motifs
moduleColormodulescolorSets the color for the specified modules
moduleFillColor None

Type

color
Specifies the color to use for the intra-module background when drawing module regions. The value can either be a color or one of the two special values:
None (do not color the background)
or
Type (color the background according to module type)
moduleOutlineColor None

Type

color
Specifies the color to use for the border when drawing module regions. The value can either be a color or one of the two special values:
None (do not draw a border)
or
Type (color the border according to module type)
expandedregion tracksbooleanSets the expansion mode of the specified Region tracks.
TRUE=expanded, FALSE=contracted
expandregion tracks Expands the specified Region tracks
This is an abbreviation of: expanded(x)=TRUE
contractregion tracks Contracts the specified Region tracks
This is an abbreviation of: expanded(x)=FALSE
height
trackHeight
tracksintegerSets the track heights for the specified tracks
scalesequencesvalue%

ToFit
Sets the zoom level for the sequences to the specified percentage value (note that the number must be followed by a percent sign) or adjusts the zoom level so that the entire sequence is visible if the special ToFit keyword is specified
orientationsequencesDirect
Reverse
Relative
Opposite
Shows the sequences according to the given strand orientation. The keywords Direct and Reverse will show the sequences on the genomic direct or reverse strand respectively. If the keyword Relative is specified, the sequences will be shown relative to the individual orientation of each sequence (and opposite will show the opposite strand.)
margin integerSpecifies the margin distance between sequences
ordertracks Sets the order of the tracks according to the given list
sortmodeAscending
Descending
The sort command was added to MotifLab in version 2.0 and will sort the sequences in the given direction according to the specified sort mode. The direction should be either "ascending" or "descending" (abbreviated "asc" and "desc"). The mode parameter specifies how the sequences should be sorted. Valid modes are:
  • Sequence name
  • Sequence length
  • Region count: <Region Dataset>
  • Visible region count: <Region Dataset>
  • Region coverage: <Region Dataset>
  • Visible region coverage: <Region Dataset>
  • Region scores sum: <Region Dataset>
  • Visible region scores sum: <Region Dataset>
  • Numeric map: <Sequence Numeric Map>
  • Numeric track sum: <Numeric Dataset>
  • GC-content: <DNA Sequence Dataset>
  • Mark
  • Location
Some of these modes require an additional data object of a certain type to be supplied as a parameter. In this case the mode should be followed by a colon and the name of the data object. It is also possible to first group the sequences together in clusters (specified by a Sequence Partition) and then sort the sequences within each cluster. To use this grouping option simply type ", group by: <Sequence Partition>" after the mode parameter. Note the comma which separates the mode from the grouping option. Alternatively, it is possible to drop the "group by:" string and just type a comma followed by the name of the Sequence Partition.
updates booleanTurns on or off visualization updates.
When updates are turned off, the Visualization panel will not be updated when e.g. new sequences are added. This setting should be used with caution, but it can be useful if you have a protocol script where many sequences are added one by one. This will tend to be inefficient since the Visualization panel is updated every time a new sequence is added. However, if you add an $updates()=OFF line before adding sequences and remember to turn updates on again with an $updates()=ON line afterwards (followed by a $refresh() line), adding all the sequences will be much more efficient. (But do remember to turn updates on again, otherwise it may cause trouble later!).
refresh  This command is required to refresh the screen in order to update the graphics properly if normal graphics updates have been turned off with $updates()=OFF.
setting  This is a general command which can be used to change any display setting as long as you know the correct name of the setting. For instance, to change the height of a track named "Conservation" to 20 you can use the command $setting("Conservation.trackHeight")=20, or to change its foreground color to red you can use $setting(Conservation.foregroundColor)=RED. (Enclosing the name of the setting in quotes is optional). However, it is not recommended to change the values of settings in this way unless you don't have any other choice, since (1) the graphics might not be properly updated in response to your command (at least you should follow such as statement with $refresh()) and (2) there are no security checks in place, so unless you know exactly what you are doing you can create serious problems by unintentionally altering some important setting (for instance by setting the height of a track to a color instead of a number).
import"filename"  Imports a set of display settings from the file with the given name. The file should be a text-file where each line is in the format: <settingname> = <value>.
displaydata object  If this command is executed in the GUI client, a popup dialog will be shown displaying the contents of the data object (this does not apply to feature tracks). Added in MotifLab v2.0.


Examples of display setting statements:
$visible(*)=YES   # Shows all current feature tracks in the visualization panel
$hideMotifs(*)   # Hides all motifs so that their TFBS are not shown within motif tracks in the visualization panel
$showMotifs(MotifCollection1,M00001,M00002,M00004)   # Shows all motifs in the collection and 3 more
$height(Conservation,RepeatMasker)=26   # Sets the height of these two tracks to 26
$margin()=10   # Sets vertical distance between sequences to 10 pixels
$color(Conservation)=RED   # Sets the color of the Conservation track to red
$color(RepeatMasker)=#0000FF   # Sets the color of the RepeatMasker track to blue
$color(CCDS)=0,255,0   # Sets the color of the CCDS track to green
$expanded(TFBS)=False   # Turns off expanded mode for the TFBS track
$order(DNA,CCDS,Conservation,RepeatMasker,TFBS)   # Changes the order of the given tracks
$moduleFillColor()=Type   # Specifies that all modules should be colored according to their type
$moduleOutlineColor()=BLACK   # Sets outline color of all modules to black
$hideRegion(RepeatMasker:*)   # Hides all regions found in the RepeatMasker track
$showRegion(AluSx,LTR2B)   # Shows regions of the AluSx and LTR2B (repeat) types
$sort(Sequence name)=asc   # Sorts sequences in ascending order by their names
$sort(Sequence length,group by:SeqPart1)=desc   # Groups the sequences by the partition SeqPart1 and then sorts them within each cluster in descending order by their sequence lengths


Display setting statements can also be used to perform a few other tasks in a protocol that are not necessarily connected to visualization.
The following table contains a few such useful statements:
SettingTargetValueDescription
saveOutputOutput Data"filename"This statement can be used to save a single Output Data object (created with the output operation to the specified file.
Note that if the protocol is executed through the command-line interface of MotifLab (not the graphical user interface), all Output Data objects that have been created by the protocol that still exists after execution finishes are automatically saved to file (the filename will be the same as the name of the Output Data object and the file-suffix will be determined by the Data Format used). Hence, this statement is only useful if you either run the protocol with the GUI-interface and want to automatically save the output rather than having to select "Save As..." from the "File"-menu afterwards, or if your protocol script creates a lot of very large Output Data objects and you want to use the delete operation along the way to free up memory (i.e. after creating an Output Data object with the output-operation, you immediately save this Output Data to file and then delete it before outputting any other data objects).
saveSession"filename" Saves the current session to the specified file
restoreSession"filename" Restores a session from the specified file
clear"Clear All Data"
"Clear Feature Data"
"Clear Sequence Data"
"Clear Modules Data"
"Clear Motifs and Modules Data"
"Clear Other Data"
"Clear Cache"
 Deletes all data objects of the specified types (or clears the cache).
log"text string" Outputs the given text string to the log. The text can contain references to data objects as described under the "direct output" section of the output-operation.
message"text string"PLAIN
INFORMATION
ERROR
WARNING
QUESTION


(the value is optional)
(MotifLab v2+) Presents a message to the user. If MotifLab is run with a graphical interface, the message will be presented in a popup dialog, and the user must click "OK" to close the dialog and continue. If a message type is specified, the dialog will be fitted with an icon reflecting the message type. If MotifLab is not run with a graphical interface, this command behaves similar to "log". The message text can contain references to data objects as described under the "direct output" section of the output-operation.
dump"display setting name" Outputs the value of the given display setting to the log. If this statement is used without providing any display settings (just "$dump()"), MotifLab will list the names and values of all currently registered display settings. This command is mainly used for debugging (and to snoop around in MotifLab's internal lookup tables)
macromacro nametext string Adds a new macro definition (MotifLab v2+).
This setting behaves a bit differently depending on whether the macro is defined with $macro(NAME)=DEFINITION or !macro(NAME)=DEFINITION.
If "macro" is preceeded by a dollar sign, the given macro definition will be treated as a default value that will be used for the macro unless a value for that macro has already been defined somewhere else (e.g. in the macro-editor of the GUI-client or by using the "-macro" option with the CLI-client). If an exclamation mark used instead of the dollar sign, the macro will always be assigned the given definition.
option"setting name"boolean
numeric value
text string
color
This command can be used to set MotifLab options that are usually configured in the Options dialog. The recognized settings are listed below (with valid values in parentheses behind each option).
  • maxConcurrentDownloads (integer)
  • concurrentThreadCount (integer)
  • networkTimeout (integer)
  • maxSequenceLength (integer)
  • autocorrectSequenceNames (boolean)
  • useFeatureDataCache (boolean)
  • useGeneIDMappingCache (boolean)

  • promptBeforeDiscard (boolean)
  • skipPositionZero (boolean)
  • notificationsMinimumLevel (integer)
  • autoSaveSessionOnExit ("Never, Always, Ask")
  • antialiasMode ("ON, OFF, DEFAULT, GASP,
                 LCD_HRGB, LCD_HBGR, LCD_VRGB, LCD_VBGR")

  • SequenceWindowSize (integer)
  • scaleSequenceLabelsToFit (boolean)
  • sequenceLabelFixedWidth (integer)
  • mainpanelBackground (color)
  • numericTrackSamplingCutoff (integer)
  • numericTrackSamplingNumber (integer)
  • numericTrackDisplayValue (integer)
  • Javascript ("None, New File, Shared File, Embed, Link")
  • CSS ("None, New File, Shared File, Embed, Link")
  • stylesheet ("None, New File, Shared File, Embed, Link")

  • ProtocolEditor_fontName (text string)
  • ProtocolEditor_fontSize (integer)
  • ProtocolEditor_antialias (boolean)

  • ProtocolColor:Data objects (color)
  • ProtocolColor:Data types (color)
  • ProtocolColor:Data formats (color)
  • ProtocolColor:Operations (color)
  • ProtocolColor:Analyses (color)
  • ProtocolColor:Programs (color)
  • ProtocolColor:Numbers (color)
  • ProtocolColor:Text strings (color)
  • ProtocolColor:Display settings (color)
  • ProtocolColor:Comments (color)
pause integer (MotifLab v2+) This command will simply instruct MotifLab to pause and wait the specified number of milliseconds before continuing. It can be used within protocols to make simple timed animations. E.g. the command "$pause()=3000" will wait for 3 seconds. The words "wait" and "sleep" are synonymous with "pause".

Macros

The possibility of defining macros to use in protocols was introduced in MotifLab v2. Macros are named entities that can be referenced in protocol scrips, and right before a protocol is to be executed all occurrences of macros will be substituted with their respective definitions. This makes it possible to rewrite parts of a protocol on-the-fly.

Macros can either be defined in the GUI's macro editor, which can be found by selecting "Macro Editor..." from the "Protocol" menu, or with the command-line argument "-macro <name> "<definition>"" in the CLI-client. Macros can also be defined within a protocol itself using a display setting command, like so
   !macro(name)=definition   

The difference between using an exclamation mark versus a dollar sign for the macro command is that the exclamation mark will always assign the new definition to the macro when the command is executed, but if you preceed the command with a dollar sign the macro will only be assigned the new definition if it is not already defined through other means (GUI macro editor or CLI-option).

There are no restrictions on the name of a macro except that it cannot contain a closing parenthesis. However, it is advisable to keep the names simple and only use letters and underscores. Also, since every instance of the macro name anywhere in the protocol will eventually be replaced by its definition, you should make sure that the name is unique enough to not cause any off-target substitutions (for example if the macro name is a substring of some other word used in the protocol).

There are two different kinds of macros in MotifLab, simple macros and list macros.

Simple macro
A simple macro will just replace every occurrence of the macro name in a protocol with the corresponding definition.
For example, the following protocol contains a macro named VALUE with the definition "942".
  !macro(VALUE)=942
  X = new Numeric Variable(VALUE)

This will result in the following protocol
  X = new Numeric Variable(942)


List macro
A list macro is defined by enclosing the macro definition in brackets. Inside the brackets you can list multiple comma-separated values. If a line in a protocol contains a list macro, MotifLab will expand that line into multiple lines with each line using the next value in the list as its macro definition. For example, the following simple protocol contains a list macro named INDEX with four listed values.
  !macro(INDEX)=[1,2,3,4]
  X_INDEX = new Numeric Variable(INDEX)

The second line in the protocol contains the macro name and will therefore be expanded into four repeated lines with each line using the next value in the list for the macro. The resulting protocol will thus look like this:
  X_1 = new Numeric Variable(1)
  X_2 = new Numeric Variable(2)
  X_3 = new Numeric Variable(3)
  X_4 = new Numeric Variable(4)

List macros can contain any kind of values, not just numbers, but using list macros to append incremental numeric suffixes to data objects and thus creating a kind of "array" of related data objects is a common scenario. For this reason, it is also possible to use the short-hand notation "[1:4]" as a list macro definition instead of listing all the numbers "1,2,3,4" explicitly. In this case, MotifLab will automatically create the list by iterating through all the numbers starting from the first value (before the colon) up to and including the second (after the colon). If the last value is smaller than the first, the numbers will appear in reverse order (e.g. the list "[7:3]" will expand to "7,6,5,4,3"). Since it is most common to start at the value 1 and go upwards, you can even drop the first value if you want in this case. Hence, the simple list macro "[10]" will expand into 10 elements numbered from 1 to 10.


Note that it is possible to nest macros so that the definition of one macro contains the name of a second macro. Every time MotifLab expands a macro into one or more lines, it will check those lines over again for the presence of additional macro names and continue to expand macros until no more macros can be found. (For this reason you should avoid circular macros at all cost since that will cause MotifLab to hang). If a line in the protocol contains more than one macro, these will be expanded in a left-to-right order.

If you have a protocol containing macros, it is possible to preview the resulting expanded protocol by selecting "Expand Macros" from the "Protocol" menu in the GUI. This will expand all recognized macros in the protocol and show the result in a new protocol file (having the same name as the original protocol but suffixed with "-[macro expanded]").


Analyses

WARNING: When you perform analyses on sequences, motifs or modules, the resulting analysis object will store the names/identifiers of these data objects but not necessarily other information about them. When you view an analysis or output it, MotifLab may dynamically add more information about the sequences/motifs/modules to the output based on their current values, but if you have modified or replaced these objects after doing the analysis, these properties may not reflect the actual values that the objects had when the analysis was performed!

This usually only applies to individual sequences/motifs/modules and not to collections and partitions (which will normally be copied by the analysis). For instance, if you perform a "Count Motif Occurrences" with a Motif Collection containing motif M00143 and you later change the matrix values of this motif, the motif logo shown when viewing the results of the analysis will not reflect the actual motif that was used when performing the analysis.

benchmark

This analysis can be applied to: Region Dataset

Description
The benchmark analysis can be used to evaluate the performance of motif discovery programs by comparing tracks with predicted TF binding sites (or other predicted regions) returned by these programs against a track containing the "correct" answer (e.g. all known TFBS in the sequences). The analysis calculates several common performance metrics (statistics), including e.g. sensitivity, specificity, positive predictive value, F-measure and Matthew's correlation as described below.

Some of the metrics (viz. sensitivity, PPV, PC, ASP and F-measure) can be evaluated at both a "nucleotide level" and "site level", whereas the remaining metrics are only defined at the "nucleotide level". The formulas for all metrics are based on four parameters that count the number of true positive instances (TP), false positives (FP), true negatives (TN) and false negatives (FN) respectively. At the "nucleotide level", a true positive is a nucleotide position that is correctly predicted as being part of a binding site (both the prediction track and answer track have regions that overlap with this nucleotide). A false positive is a nucleotide position that is within a region in the prediction track but not in the answer track (the nucleotide is wrongly predicted to be within a TFBS). A true negative is a nucleotide that is correctly predicted to not be within a TFBS but rather being part of the background sequence (it is outside regions in both the prediction and answer tracks). A false negative is a nucleotide that is predicted to be part of the background sequence when it is actually within a true TFBS (it is outside of regions in the prediction track but inside a region in the answer track).

At the "site level", a region in the answer track that is overlapped by a region in the prediction track is counted as a true positive, a region in the answer track that is not overlapped by a predicted region is called a false negative and a predicted region that does not overlap with a region in the answer track is called a false positive (true negatives are not counted at the "site level"). The minimum amount of overlap between the answer region and predicted region that is required in order to call it a true positive can be specified as a parameter to the analysis.

If the benchmark analysis is based on several sequences, the TP/FP/TN/FN parameters will be counted for each sequence and then summed up to produce a total for the whole dataset before calculating the statistics below.

MetricDescriptionDefinition
Sensitivity (Sn)Fraction of target regions that was correctly predicted. This metric is also called "recall".TP/(TP+FN)
Specificity (Sp)Fraction of background that was correcly predictedTN/(TN+FP)
Positive predictive value (PPV)Fraction of predicted regions that correctly correspond to true target regions. This metric is also called "precision".TP/(TP+FP)
Negative predictive value (NPV)Fraction of predicted background that correctly correspond to true backgroundTN/(TN+FN)
Performance coefficient (PC)The ratio between the intersection and union of the answer and prediction tracks. This metric is also called "Jaccard index".TP/(TP+FP+FN)
Average site performance (ASP)The arithmetic mean of sensitivity and PPV1/2*(TP/((TP+FN))+TP/((TP+FP)))
F-measure (F)The harmonic mean of sensitivity and PPV2TP/(2TP+FP+FN)
Accuracy (Acc)The fraction of nucleotides in the sequences that were correctly classified (as either true target regions or true background)(TP+TN)/(TP+TN+FP+FN)
Correlation coefficient (CC)The correlation between the regions in the prediction track and the target regions in the answer track((TP*TN)-(FP*FN))/sqrt((TP+FN)(TN+FP)(TP+FP)(TN+FN))

All of these metrics, except CC, has a range between 0 (worst score) and 1.0 (best score). The CC metric has a range from -1.0 to 1.0, where a score of 1.0 means that the prediction and answer tracks are equal (at least in terms of overlapping regions), a score of -1.0 means that the prediction track is exactly the opposite of the answer track (all true regions were predicted as background and all true background nucleotides were predicted as being within TFBS). A score of 0 means that there is no correlation between the prediction track and the answer track (such a result would be expected if the predictions were based on random guessing).

Some motif discovery methods are based on stochastic algorithms and may produce different results if run several times on the same dataset. For such methods it would be useful to report the average results (with standard deviation) across multiple runs. The benchmark analysis allows the results for multiple prediction tracks for the same method to be combined into a single average statistic. In order to do this, the "Aggregate" parameter flag must be set (see below) and the tracks must be given names in the format "methodname_number", i.e. the name of the track (which is often the name of the method) must be suffixed by an underscore followed by a number (which need not be incremental). For example, if you have run a method based on Gibbs sampling five times and the TFBS prediction tracks returned by this program are given the names "Gibbs_1", "Gibbs_2", "Gibbs_3", "Gibbs_4" and "Gibbs_5", the benchmark analysis will take the average score for each metric across these five tracks and present the results as a method called "Gibbs". Standard deviations are shown as error bars in the bar plot (in current versions of MotifLab the standard deviations are not reported as numbers).

The analysis compares the answer track to all other Region Datasets known to MotifLab, but only results for Region Datasets that are currently visible in the GUI will be included when the Analysis object is examined or output to HTML or RawData formats. The order of the tracks in the output is based on their order in the Features Panel, and the colors used for the tracks in the bar chart are based on the current colors of the tracks. If MotifLab is run without the GUI in command-line mode, the visibility of the tracks can be set in the protocol with the "$show(trackname)" and "$hide(trackname)" display setting statements. The colors of the tracks can be set with "$color(trackname)=color" and the order of the tracks can be set with "$order(track1,track2,...,trackN)". These commands can also be used for aggregated tracks if the dollar sign is exhanged for an exclamation sign. E.g. to set the color for the aggregated "Gibbs" track based on the five tracks mentioned above, a command like "!color(Gibbs)=RED" could be used. It is also possible to specify the colors to use for the different performance metrics by using commands on the form "$setting("systemColor.Sensitivity")=RED". The standard colors for these metrics are defined in the startup script for MotifLab (go to the "Configure" menu and select "Edit Startup Script" to see how each one can be changed).

Arguments
NameDescription
Answer This parameter specifies which region track should be used as the "correct answer" that the prediction tracks should be compared against. Note that the prediction tracks to compare with the "answer" track is not specified. Rather, all other Region Datasets are automatically evaluated against the answer (but only the results for currently visible tracks are included in the output at any given time).
Groups This optional parameter can either specify a Sequence Collection or a Sequence Partition. If a Sequence Collection is specified, the analysis will be restricted to sequences contained in this collection. If a partition is provided, separate benchmark analyses will be performed for each individual cluster in addition to a combined analysis based on all sequences in the partition. If the parameter is left undefined, the benchmark analysis will be based on all sequences.
Aggregate If this parameter flag is set, the benchmark analysis will group tracks together if they start with the same name prefix and end with a suffix consisting of an underscore followed by an integer number (i.e. three tracks named "xxx_1", "xxx_2" and "xxx_3" will be grouped together as "xxx"). For each such group, the analysis will return a single combined score for each performance metric by taking the average value of the scores obtained for each individual track in the group.
Site overlap A number (which should be greater than 0 and smaller than or equal to 1.0) which specifies the minimum fraction of a target region (in the "Answer" track) that is required to be overlapped by a prediction in order to call that prediction a "true positive" (TP) on the "site-level".

See also: Region Dataset, Sequence Partition, compare region datasets


binding sequence occurrences

This analysis can be applied to: Region Dataset

Description
This analysis is somewhat similar to the Count Motif Occurrences analysis, except that instead of just reporting the number of sites found for each motif (based on region type), the counts are further subdivided based on the sequence property of the motif site, which means that for each motif the analysis reports the number of sites found for each unique binding sequence. For example, if a motif with consensus "CAsGTG" occurs a total of 7 times, the analysis could report that it occurs 4 times with the specific binding sequence "CACGTG" and 3 times with the binding sequence "CAGGTG". For each combination of motif and specific binding sequence, the analysis reports how many occurrences there are in total of that binding combination, the number of sequences that contains this combination and also a match score for this combination. The match score is a relative score between 0 and 100 that reflects how well the specific binding sequence matches the motif. The best matching binding sequence (the one which gives the highest score according to the binding matrix) is given a score of 100 and the worst possible match is given a score of 0.

Arguments
NameDescription
Motif track This parameter specifies the motif track containing the binding sites that will be counted. The motif regions should have defined "sequence" properties that specify the actual binding sequence each the site.
Motifs This parameter specifies the motifs for which binding sequences will be counted.
Sequences If a Sequence Collection is selected for this optional parameter, the analysis will only count binding sites within sequences from this collection. If left empty, all sequences will be considered.
Within regions If a Region dataset is selected for this optional parameter, only motif sites that are located fully within the regions in this dataset will be counted. If left empty, all motif sites in the sequences will be considered.

See also: count motif occurrences


compare clusters to collection

No documentation currently available.



compare collections

This analysis can be applied to: Collection

Description
This analysis compares two collection objects (of the same type) to see if they have any entries in common. The analysis reports the number of entries that are present in both collections, in one of the collections but not the other and also the number of entries that not present in either of the two collections (but are present in a "total" collection). The analysis also calculates p-values which reflect the probability that the two collections should have at least the observed number of entries in common (or at most this number of entries in common) assuming the entries for the two collections had been randomly sampled from a larger collection (called "total").

Arguments
NameDescription
First This parameter specifies the first of the two collections.
Second This parameter specifies the second of the two collections.
Total This optional parameter specifies a larger collection that is used when calculating p-values. The "total" collection should include all entries from the two collections above (first and second) and perhaps other entries as well. If left unspecified it will default to a collection containing all known data objects of the relevant type (e.g. if the two collections are motif collections, the "total" collection will default to a collection containing all known motifs).



compare motif occurrences

This analysis can be applied to: Region Dataset

Description
This analysis will count the number of times each type of motif occurs in one set of sequences (target set) and compare this to the number of times the motifs occur in a second set (control set). Statistical tests (either binomial test of hypergeometric test) will assess whether some motifs occur significantly more often in one of these sets compared to the other. The output contains counts of how many times each motif type occurs in the target set and control set respectively and also p-values for the target and control sets. These p-values reflect the probability of encountering the observed number of hits (or higher) given an expected number of hits based on each motif's frequency in the opposite set. E.g. If a specific motif occurs N times in the target set and M times in the control set, the reported "target p-value" will be the p-value of observing N or more motif hits in a dataset of the same size as the target set based on an expected motif frequency given by M divided by the size of the control dataset (or more accurately the maximum number of times a motif of that size could occur within such a dataset). Motifs that are significantly overrepresented in the target set are marked in red colors in the output, whereas those that are significantly overrepresented in the control set are marked in green. Motifs that are occur in both sets but are not significantly overrepresented in either set are marked with yellow.

Arguments
NameDescription
Motif track This parameter specifies the motif track containing the binding sites that will be counted.
Motifs This parameter specifies the motifs which will be considered in the analysis.
Target set This parameter specifies the first set of sequences. The motif occurrences in this set will be compared against those in the "control set" below.
Control set This parameter specifies the second set of sequences. The motif occurrences in this set will be compared agaisnt those in the "target set" above.
Within regions If a Region dataset is selected for this optional parameter, only motif sites that are located fully within the regions in this dataset will be counted. If left empty, all motif sites in the sequences will be considered.
Statistical test This parameter specifies the statistical test to use for assessing whether a particular motif is significantly overrepresented in one sequence set compared to the other. The options are:
  • Binomial: This test counts the number of times each motif occurs in each sequence set and calculates occurrences frequencies based on these counts divided by the maximum number of possible occurences in each set. Given an observed motif count (for either target or control set), the binomial test considers the probability of encountering at least this many motif hits given an expected frequency based the observed frequency in the opposite sequence set.
  • Hypergeometric: This test only considers the number of sequences in the target and control set that contain each motif and not the actual number of occurrences. Let us say the target set has N sequences and n of these contains the motif. The control set on the other hand has M sequences with m containing the motif. So we have a total of N+M sequences of which n+m contains the motif. The hypergeometric test assesses the probability that n or more sequences should contain the motif if we were to pick N sequences at random from the total set (for comparing the target set to the control).
Significance threshold The (uncorrected) p-value threshold below which motifs are considered to be significantly overrepresented in a sequence set. Significant p-values below the (corrected) threshold are marked with either red color (for the target set) or green color (for the control set) when output.
Bonferroni correction This parameter can be used to apply automatic Bonferroni correction to the significance threshold above to account for multiple hypothesis testing. Bonferroni correction is a straightforward way of correcting the threshold by simply dividing the threshold value by the number of hypotheses (i.e. motifs). The threshold can either be divided by the number of motifs tested ("All motifs") or the number of different motifs actually encountered in the motif track ("Present motifs"). If other forms of correction are required, this can be achieved by selecting "None" for this parameter (turn of automatic correction) and rather correct the threshold manually. For example, Bonferroni correction assumes that all hypotheses (motifs) are independent of each other, which will usually not be the case since motif collections tend to contain many similar motifs. Setting the Bonferroni correction to "All motifs" in this case would lead to an overly strict threshold. A better option then would be to e.g. cluster all similar motifs together (using for example a Motif Partition), count the number of motif clusters and set the significance threshold to the uncorrected value divided by the number of motif clusters.

See also: count motif occurrences, compare region occurrences


compare motif track to numeric track

This analysis can be applied to: Region Dataset and Numeric Dataset

Description
This analysis will compare a motif track against a numeric track and examine the numeric values found within each motif site. For each type of motif, the location of all binding sites (TFBS) for this motif are found. Next, different statistics are calculated based on the values that the chosen numeric track has within these TFBSs, including the smallest (minimum) value in the track within all TFBSs for each motif, the largest (maximum) value, the sum of all values within positions covered by TFBSs and the average value of the numeric track within the TFBSs (found by taking the sum and dividing by the total number of positions within the TFBSs). In addition, the analysis will also count the number of TFBSs for each motif where the average value of the numeric track within the TFBS (found by summing up the values within the TFBS and dividing by the length of the TFBS) is greater than (or equal to) some selected threshold.

Arguments
NameDescription
Motif track This parameter specifies the motif track containing the binding sites that will be considered in the analysis.
Motifs This parameter specifies the motifs whose binding sites will be considered in the analysis.
Sequences If a Sequence Collection is selected for this optional parameter, the analysis will only consider binding sites within sequences from this collection. If left empty, all sequences will be included.
Numeric track This parameter specifies the numeric track that the motif track will be compared against
Threshold One of the statistics reported by the analysis (called "count above threshold") will be based on the number of TFBSs for each motif where the average value of the numeric track within the TFBSs is greater than (or equal to) the threshold value specified here. For example, if this threshold is set to 0.8 and "Conservation" is selected for the numeric track, the analysis will report the number of TFBSs for each motif that have an average conservation score above (or equal to) 0.8.



compare region datasets

This analysis can be applied to: Region Dataset

Description
This analysis compares two region datasets and calculates several ("nucleotide level") statistics based on their overlap, namely sensitivity (SN), specificity (SP), positive predictive value (PPV), negative predictive value (NPV), performance coefficient (PC), average site performance (ASP), F-measure (F), accuracy (Acc) and Matthews correlation coefficient (CC). See the "benchmark" analysis for a detailed description of these statistics. The formulas for all these statistics are based on four parameters that count the number of true positive nucleotides (TP), false positives (FP), true negatives (TN) and false negatives (FN) respectively. A true positive is a nucleotide position that is inside a region in both of the two Region Datasets. A false positive is a nucleotide position that is within a region in the first dataset but not in the second dataset. A true negative is a nucleotide that is outside regions in both datasets. A false negative is a nucleotide that is outside a region in the first dataset but inside a region in the second dataset. The analysis will also show a pie chart illustrating how much overlap there is between regions in the two datasets (fraction of nucleotides within regions in both sets), as well as the fraction of positions within regions that are unique to either the first or the second dataset and finally the fraction of nucleotides that are outside regions in both datasets ("background").

Arguments
NameDescription
First This parameter specifies the first of the two Region Datasets to be compared
Second This parameter specifies the second of the two Region Datasets to be compared
Sequences If a sequence collection is specified for this optional parameter, the analysis will be limited to sequences in this collection

See also: benchmark


compare region occurrences

This analysis can be applied to: Region Dataset

Description
This analysis will count the number of times each type of region occurs in one set of sequences (target set) and compare this to the number of times the regions occur in a second set (control set). A hypergeometric test will assess whether some regions occur significantly more often in one of these sets compared to the other. The output contains counts of how many times each region type occurs in the target set and control set respectively and also p-values for the target and control sets. Regions that are significantly overrepresented in the target set are marked in red colors in the output, whereas those that are significantly overrepresented in the control set are marked in green. Regions that are occur in both sets but are not significantly overrepresented in either set are marked with yellow.

Arguments
NameDescription
Region track This parameter specifies the track containing the regions that will be counted.
Target set This parameter specifies the first set of sequences. The region occurrences in this set will be compared against those in the "control set" below.
Control set This parameter specifies the second set of sequences. The region occurrences in this set will be compared agaisnt those in the "target set" above.
Statistical test This parameter specifies the statistical test to use for assessing whether a particular region type is significantly overrepresented in one sequence set compared to the other. So far there is only one option:
  • Hypergeometric: This test only considers the number of sequences in the target and control set that contain each region and not the actual number of occurrences. Let us say the target set has N sequences and n of these contains a particular region type. The control set on the other hand has M sequences with m containing the region. So we have a total of N+M sequences of which n+m contains the region. The hypergeometric test assesses the probability that n or more sequences should contain the region if we were to pick N sequences at random from the total set (example the target set).
Significance threshold The (uncorrected) p-value threshold below which region types are considered to be significantly overrepresented in a sequence set. Significant p-values below the (corrected) threshold are marked with either red color (for the target set) or green color (for the control set) when output.
Bonferroni correction This parameter can be used to apply automatic Bonferroni correction to the significance threshold above to account for multiple hypothesis testing. Bonferroni correction is a straightforward way of correcting the threshold by simply dividing the threshold value by the number of hypotheses (i.e. region types) encountered in the datasets ("Present regions"). Selecting "None" for this parameter will turn of Bonferroni correction.

See also: count region occurrences, compare motif occurrences


count module occurrences

This analysis can be applied to: Region Dataset

Description
This analysis counts the number of times each module occurs in a given module track (i.e. the number of sites for each module), and reports the total count for each module and also the number of sequences that contain each module.

Arguments
NameDescription
Module track This parameter specifies the module track containing the module sites that will be counted.
Module This parameter specifies the modules for which occurrences will be counted.
Sequences If a Sequence Collection is selected for this optional parameter, the analysis will only count module sites within sequences from this collection. If left empty, all sequences will be considered.
Within regions If a Region dataset is selected for this optional parameter, only module occurrences that are located fully within the regions in this dataset will be counted. If left empty, all module occurrences in the sequences will be considered.

See also: count motif occurrences, count region occurrences


count motif occurrences

This analysis can be applied to: Region Dataset

Description
This analysis counts the number of times each motif occurs in a given motif track (i.e. the number of binding sites for each motif), and reports the total count for each motif and also the number of sequences that contain each motif. If a Motif Numeric Map containing expected frequencies for each motif is specified (number of motif sites expected per position in the sequence), a p-value representing the probability of encountering at least as many motif instances as observed in the sequences will be reported and the statistical significance of motif overrepresentation will be assessed by a binomial test.

Arguments
NameDescription
Motif track This parameter specifies the motif track containing the binding sites that will be counted.
Motifs This parameter specifies the motifs for which binding sites will be counted.
Sequences If a Sequence Collection is selected for this optional parameter, the analysis will only count binding sites within sequences from this collection. If left empty, all sequences will be considered.
Within regions If a Region dataset is selected for this optional parameter, only motif sites that are located fully within the regions in this dataset will be counted. If left empty, all motif sites in the sequences will be considered.
Background frequencies If a Motif Numeric Map containing expected frequencies for each motif is specified for this optional parameter (number of motif sites expected per position in the sequence), a p-value representing the probability of encountering at least as many motif instances as observed in the sequences will be reported. The statistical significance of motif overrepresentation will be assessed by a binomial test and compared against a specified significance threshold (possibly corrected for multiple hypothesis testing). P-values of motifs that are significantly overrepresented (below the corrected p-value threshold) will be marked with a light red color when output. For motifs that have an expected frequency of 0.0, the binomial test can not be used to assess significance. Such motifs will be assigned a default p-value of 0.0 and be marked with a saturated red color in the output.
Significance threshold The (uncorrected) p-value threshold below which motifs are considered to be significantly overrepresented. Significant p-values below the (corrected) threshold are marked with red background colors when output.
Bonferroni correction This parameter can be used to apply automatic Bonferroni correction to the significance threshold above to account for multiple hypothesis testing. Bonferroni correction is a straightforward way of correcting the threshold by simply dividing the threshold value by the number of hypotheses (i.e. motifs). The threshold can either be divided by the number of motifs tested ("All motifs") or the number of different motifs actually encountered in the motif track ("Present motifs"). If other forms of correction are required, this can be achieved by selecting "None" for this parameter (turn of automatic correction) and rather correct the threshold manually. For example, Bonferroni correction assumes that all hypotheses (motifs) are independent of each other, which will usually not be the case since motif collections tend to contain many similar motifs. Setting the Bonferroni correction to "All motifs" in this case would lead to an overly strict threshold. A better option then would be to e.g. cluster all similar motifs together (using for example a Motif Partition), count the number of motif clusters and set the significance threshold to the uncorrected value divided by the number of motif clusters.

See also: count module occurrences, count region occurrences, compare motif occurrences, Motif Numeric Map


count region occurrences

This analysis can be applied to: Region Dataset

Description
This analysis counts the number of times each region type occurs in a given region track and reports the total count for each region type and also the number of sequences that contain each region type. For example, for a track containing repeat regions, the analysis will first determine which types of repeat regions are present in the sequences (e.g. different types of "Alu" repeats, SINEs, LINEs and simple repeats etc.) and then count the number of times each such repeat type occurs.

Arguments
NameDescription
Region track This parameter specifies the region track containing the regions that will be counted.
Sequences If a Sequence Collection is selected for this optional parameter, the analysis will only count regions within sequences from this collection. If left empty, all sequences will be considered.

See also: count motif occurrences, count module occurrences


evaluate prior

This analysis can be applied to: Region Dataset

Description
One of the key functionalities of MotifLab (and its predecessor PriorsEditor) is the ability to create numeric tracks that can be used as positional priors to guide motif discovery programs by assigning higher scores to positions that are considered more likely to harbour transcription factor binding sites. Such priors tracks can be created manually step-by-step by using different operations to combine information from multiple feature tracks or they can be generated automatically with PriorsGenerators that have been trained to discover the relationship between binding site occurrences and other genomic features. In either case, it will be useful to evaluate the potential of positional priors tracks generated in a certain way by comparing such a priors track against a region track containing known binding regions, to see if the track generated with this particular approach indeed has higher values inside these regions compared to outside. The "evaluate prior" analysis will do just this.

The analysis has two different modes of operation depending on whether or not the optional "Priors track" parameter has been specified. If no "Priors track" has been selected, the analysis will be run in "general mode". However, if a "Priors track" has been selected, this particular track will be analyzed in more detail in "specific mode".

General mode
In general mode, all available numeric tracks and region tracks will be compared to the given target track and evaluated. For each track, a ROC-curve will be generated reflecting its potential for discriminating positions within regions from background positions based on the track's score at each position. Also, the area under the curve (AUC) will be calculated for the ROC-curve. The ROC-curve for a track is generated in the following way: First, all the positions within the track are sorted in ascending order according to the value at each position. Then, starting at (0,0) in the graph and going through the sorted positions one by one, the ROC-curve moves one step up if the next sorted position is within a region in the target track and one step to the right if the next sorted position is outside of any regions. After all positions have been covered, the ROC-curve should end up at coordinate (1,1). (Note that the ROC-graph has been normalized so that the x-axis represents the fractional number of positions that lie outside of regions and the y-axis represents the fractional number of positions that lie within regions). Hence, if a certain priors track tends to have higher values within regions of the target track compared to outside, the graph will tend to move more upwards at the beginning and then to the right at the end, resulting in a larger area under the curve. One the other hand, if a track tends to have higher values outside of the target regions, the graph will move to the right at the beginning and then more upwards towards the end, resulting in a smaller area under the curve. Higher AUC values thus means that the priors track tends to have higher values inside of target regions. If all positions inside of regions have higher prior values than the background (so a clear separation between regions and background can be made based on the priors values), the ROC-curve will move from (0,0) to (0,1) and then to (1,1) which gives a perfect AUC-score of 1.0. If a priors track tends to give equally high values to positions inside and outside of regions (so the positions inside and outside are about uniformally distributed when sorted by numeric value), the ROC-curve will tend to move in a straight diagonal line from (0,0) to (1,1) resulting in a AUC-score of 0.5. In this case, the numeric priors track shows no ability to discriminate between regions and background. ROC-curves for region tracks are calculated in a similar fashion by treating positions within regions as having a numerical value of 1.0 and positions outside regions as having the value 0.0.

Note that even though ROC-curves and AUC-scores are calculated for all available numeric and region tracks, only the tracks that are currently visible in the GUI will be included in the graph whenever the analysis is displayed in a dialog or output using the "output" operation. Hence, if you only wish to include a few selected tracks in the graph, you can hide the tracks you don't want to include. Also, the color used for the ROC-curve of each track will be the same as the currently selected display color for that track. For analyses performed outside the GUI (running in CLI-mode from a protocol script), display setting statements can be used to hide tracks and set the colors for each track.

Specific mode
If a specific numeric track has been selected for the "Priors track" parameter, the analysis will be performed in "specific mode" which gives a more in-depth and detailed analysis of the potential of using the selected track as positional priors. First, the ROC-curve and area under the curve (AUC) is calculated for the priors track the same way as if the analysis had been performed in "general mode". Second, a "precision-recall" graph is calculated that shows the maximum "precision" (positive predictive value) that can be achieved for different recall (sensitivity) levels.

The analysis will also produce additional graphs showing how the scores for several different nucleotide-level performance statistics will vary depending on a chosen cutoff threshold for the selected priors track. For a given threshold level, all positions where the value of the priors track is higher than or equal to this threshold (or strictly higher depending on the 'threshold' parameter) are considered "positive" positions and all positions with values below the threshold are considered as "negative". Positive positions that are within target regions are further classified as "true positives" (TP) and those outside are classified as "false positives" (FP). Conversely, negative positions inside target regions are classified as "false negatives" (FN) and those outside as "true negatives" (TN). These four parameters (TP/FP/FN/TN) serve as basis for calculating several nucleotide-level statistics that are described in detail in the manual entry for the benchmark analysis. For each nucleotide-level statistic, such as e.g. sensitivity, the threshold will be varied from the lowest numeric value in the priors track to the highest value (in increments of 1/100 of the range) and the graph will show the performance that can be achieved according to that statistic for each threshold level. For example, when evaluating "Conservation" as a priors track for predicting TFBS, the sensitivity value (y-axis) at threshold=0.65 (x-axis) reflects the fraction of TFBS positions that are correctly predicted if we assume that all positions that have a Conservation value of 0.65 or higher reside within TFBSs. The analysis will also determine two "optimal thresholds". The first is for the threshold value which gives the best trade-off between sensitivity and specificity (which is to say the threshold which results in the highest arithmetic mean of the sensitivity and specificity scores), and the second optimal threshold is the one which results in the highest possible score for the accuracy statistic.

Arguments
NameDescription
Target track This parameter should specify a Region Dataset containing known instances of the regions that are predicted by the positional priors track(s) being evaluated (i.e. for evaluating positional priors to predict TF binding sites, the track should contain TF binding sites). The track should preferably be complete and representative for the given region type.
Priors track This optional parameter can specify a particular positional priors track to analyze in "specific mode". If no track is selected here, the analysis will be done in "general mode".
Sequences If a sequence collection is specified for this optional parameter, the analysis will be limited to sequences from this collection.
Threshold The threshold parameter selects which comparison operator to use for classifying positions as either "positives" or "negatives" when the analysis is performed in "specific mode". The setting "Above or equal" will classify all positions that have priors values equal to or above the current threshold level as positive (and those below as negative) whereas the setting "Strictly above" will classify positions with values above the current threshold level as positive (and those with values equal to or below as negative).

See also: benchmark, numeric dataset distribution


GC-content

This analysis can be applied to: DNA Sequence Dataset

Description
This analysis calculates the GC-content (percentage) in a given DNA track for every sequence and possibly also additional statistics for a group or groups of sequences (such as the minimum, maximum, average and median GC-content for the sequences in the group).

Arguments
NameDescription
DNA track This parameter specifies which DNA track to calculate GC-content for.
Groups This optional parameter can either specify a Sequence Collection or a Sequence Partition. If a Sequence Collection is specified, the analysis will be restricted to sequences contained in this collection and it will also calculate the minimum, maximum and average GC-content (with standard deviation) for the sequences in the group, along with the median value and 1st and 3rd quartiles. If a Sequence Partition is specified, the statistics mentioned above will be calculated separately for each cluster of sequences in the partition. If the parameter is left undefined, the GC-content for every sequence will be reported, but no other statistics will be given. To calculate GC-statistics based on all sequences, make sure to select the "AllSequences" collection.

See also: Sequence Collection, Sequence Partition


motif collection statistics

This analysis can be applied to: Motif Collection

Description
Calculates statistics related to motif size, IC-content and GC-content for the motifs in a given collection. The analysis reports the minimum, maximum, average, standard deviation, median and 1st and 3rd quartiles for these three motif properties and also shows histograms of their distributions.

Arguments
NameDescription
Motif Collection The Motif Collection to apply the analysis to



motif position distribution

This analysis can be applied to: Region Dataset

Description
This analysis will analyze the positional distribution of each motif in a motif track. It can be used to assess whether motifs of certain types are uniformly distributed within sequences or if they tend to be located in the same location relative to a selected alignment anchor position across sequences (for example if some motifs tend to occur at the same distance relative to the transcription start site in several different sequences). To perform the analysis, the sequences are first aligned according to the selected anchor. Next, for each motif type the binding sites (TFBS) for this motif are located and a distribution is calculated based on the distance between the center of each TFBS and the alignment anchor. Different statistics can be calculated based on this distribution, but so far the only statistics reported are the standard deviation and kurtosis. In addition to these two statistics, graphical histograms can be created which shows the distribution of the binding sites for each motif type.

Arguments
NameDescription
Motif track This parameter specifies the motif track containing the binding sites that will be considered in the analysis.
Motifs This parameter specifies the motifs whose binding sites will be considered in the analysis.
Sequences If a Sequence Collection is selected for this optional parameter, the analysis will only consider binding sites within sequences from this collection. If left empty, all sequences will be included.
Alignment anchor This parameter specifies an alignment anchor for each sequence which will serve as the reference point when estimating the relative position of each motif site (TFBS). This setting is only important if the sequences have different lengths or if the relative position of TSS/TES varies between sequences. If all sequences have the same lengths, the upstream/downstream/center anchors will all give the same result, and if in addition the relative position of TSS/TES is the same, all anchors will give the same results. Note that sequences are always aligned according to their relative orientation.
  • TSS: The sequences will be aligned at the Transcription Start Site (TSS).
  • TES: The sequences will be aligned at the Transcription End Site (TES)
  • Upstream: The sequences will be aligned at their upstream end.
  • Downstream: The sequences will be aligned at their downstream end.
  • Center: The sequences will be aligned at their center position.
Include histograms If this option is selected, histograms reflecting the positional distribution of the binding sites for each motif is computed and the data for these histograms are stored in the analysis data object. Note that even if this option is not selected, MotifLab will attempt to generate histograms on-the-fly when displaying the analysis object in the GUI. However, in order to include such histograms in output documents (e.g. HTML or Excel) or include histograms in collated analyses, this option must be selected.
Motif anchor When calculating the standard deviation and kurtosis of the positional distribution, the distance between the motif and the alignment anchor is always measured from the center of the motif site (TFBS). However, when creating the histogram, the motif anchor parameter can be used to specifiy how to select the target bin(s) in the histogram in relation to the location of a motif site (TFBS).
  • Upstream: The TFBS is assigned to the bin covering the most upstream position in the site.
  • Center: The TFBS is assigned to the bin covering the center position in the site.
  • Downstream: The TFBS is assigned to the bin covering the most downstream position in the site.
  • Span: The TFBS is assigned to all bins overlapping with the span of the site.
Support If this option is selected, each bin will only be counted once for each sequence and the histogram will reflect the number of sequences that have a binding site for that bin, not the total number of binding sites that are assigned to the bin.
Bins An integer number which specifies how many bins to divide the sequence range into for the histograms



motif regression

This analysis can be applied to: Region Dataset

Description

Arguments
NameDescription
Motif track This parameter specifies a motif track
Motifs This parameter specifies which motifs to consider in the analysis.
Sequence values If this parameter flag is set, the benchmark analysis will group tracks
Sequences If a sequence collection is seleted for this optional parameter, the analysis will be limited to include only sequences from this collection.
Skip non-regulated This parameter allows
Normalize

See also: single motif regression


motif similarity

This analysis can be applied to: Motif

Description
This analysis will compare a single selected motif against a collection of motifs using all motif similarity metrics that are known to MotifLab (which currently include "Average Log-Likelihood Ratio","Chi-squared","Kullback-Leibler Divergence","Pearson's Correlation","Pearson's Correlation (weighted)" and "Sum of Squared Distances"). The analysis will report the raw score values for these metrics.

Arguments
NameDescription
Target motif The target motif that the other motifs should be compared against
Motifs The collection of motifs to compare against the target motif



numeric dataset distribution

This analysis can be applied to: Numeric Dataset

Description
This analysis will calculate distribution statistics for a Numeric Dataset; namely the number of bases in the track, the minimum and maximum values, the average and standard deviation and 1st, 2nd (median) and 3rd quartiles. If an optional Region Dataset is specified, the analysis will calculate separate statistics based on values inside regions in this dataset versus values outside these regions. A histogram will also be created showing the distribution of the values. In this histogram, the 1st/2nd/3rd quartiles plus the min and max values will be shown in a box-and-whiskers plot, whereas the average value will be shown as a diamond with standard deviation illustrated by arrows.

Arguments
NameDescription
Numeric dataset This parameter specifies the Numeric Dataset that will be analyzed.
Region dataset If this optional parameter specifies a Region Dataset, the distribution statistics will be calculated separately for positions inside regions in this dataset and positions outside regions. If the parameter is left undefined, only one set of statistics will be calculated based on all values in the track.
Sequences If this optional parameter is specified, the analysis will be limited to the sequences in this sequence collection. If left undefined, all sequences will be included in the analysis.
Normalize The graphical histogram generated by this analysis will show how large fraction of the bases in the track that have values falling within the value range of each histogram bin. If the Region dataset parameter above is defined, selecting this "normalize" parameter will normalize the histograms for the "inside regions" distribution and "outside regions" distribution independently of each other (so that each distribution sums to 100%) while showing them at the same scale in the plot. If the normalize parameter is not selected, the two distributions will be scaled so that they together sum to 100%. If one the two distributions are based on very few bases compared to the other, the histogram for that distribution can appear relatively small (low in height) compared to the other when both are plotted at the same scale. The normalization parameter will only affect the appearance (relative heights) of the histograms and not the distribution statistics.
Bins An integer number specifying the number of bins to divide the value range into for the histogram
Cumulative histogram If this parameter is selected, the histogram(s) will show the cumulative distribution(s) where each bin reflects the fraction of bases that have values equal to or lower than the (upper) value for that bin.

See also: numeric map distribution


numeric map correlation

This analysis can be applied to: Numeric Map

Description
This analysis compares two Numeric Maps to determine if the values for corresponding entries are correlated (i.e. if entries that have relatively high values in the first map also have relatively high values in the second map, etc). The analysis calculates and reports two correlation statistics, namely "Pearson's correlation" and "Spearman's (rank) correlation"

Arguments
NameDescription
First This parameter specifies the first of the two maps to compare against each other
Second This parameter specifies the second of the two maps to compare against each other. Note that this must be of the same type as the first map.
Collection If this optional parameter is specified, the correlation analysis will be limited to entries in this collection (which must be of the same basic type as the two maps). If left unspecified, all the entries in the map will be considered.



numeric map distribution

This analysis can be applied to: Numeric Map

Description
This analysis will calculate distribution statistics for the values in a Numeric Map; namely the number of entries, the minimum and maximum values, the average and standard deviation and 1st, 2nd (median) and 3rd quartiles. If an optional Partition is specified, the analysis will calculate separate distribution statistics for each cluster in the Partition. A histogram will also be created showing the distribution of the values. In this histogram, the 1st/2nd/3rd quartiles plus the min and max values will be shown in a box-and-whiskers plot, whereas the average value will be shown as a diamond with standard deviation illustrated by arrows.

Arguments
NameDescription
Numeric Map This parameter specifies the Numeric Map that will be analyzed.
Group This optional parameter can either specify a Collection or a Partition of the same type as the Numeric Map. If a Collection is specified, the distribution statistics will only be based on entries from that collection. If a Partition is specified, the analysis will calculate separate distribution statistics for each cluster in the Partition. If left undefined, the distribution will be based on all entries in the Numeric Map. (Note that entries with defaulting values will always be included).
Normalize The graphical histogram generated by this analysis will show how large fraction of entries in the Numeric Map that have values falling within the value range of each histogram bin. If a Partition is selected for the "Group" parameter above, selecting this "normalize" parameter will normalize the histograms for each cluster in the Partition independently of each other (so that each distribution sums to 100%) while showing them at the same scale in the plot. If the normalize parameter is not selected, the distributions will be scaled so that they together sum to 100%. If some of the clusters have very few entries compared to others, the histogram for those distributions can appear relatively small (low in height) compared to the others when all are plotted at the same (unnormalized) scale. The normalization parameter will only affect the appearance (relative heights) of the histograms and not the distribution statistics.
Bins An integer number specifying the number of bins to divide the value range into for the histogram

See also: numeric dataset distribution


region dataset coverage

This analysis can be applied to: Region Dataset

Description
This dataset looks at the coverage of regions in a Region Dataset and calculates the fraction of each sequence that is covered by regions (in terms of nucleotides). It can also calculate min/max/average/median coverage statistics for a single group of sequences (specified as a Sequence Collection) or several groups of sequences (specified as clusters in a Sequence Partition).

Arguments
NameDescription
Region dataset This parameter specifies the region track that should be analyzed
Groups This optional parameter can either specify a Sequence Collection or a Sequence Partition. If a Sequence Collection is specified, the analysis will be restricted to sequences contained in this collection and it will also calculate the minimum, maximum and average region coverage (with standard deviation) for the sequences in the group, along with the median value and 1st and 3rd quartiles. If a Sequence Partition is specified, the statistics mentioned above will be calculated separately for each cluster of sequences in the partition. If the parameter is left undefined, the region coverage for every sequence will be reported, but no other statistics will be given. To calculate coverage statistics based on all sequences, make sure to select the "AllSequences" collection for this parameter.

See also: GC-content


single motif regression

No documentation currently available.



Tools

MotifLab's graphical interface includes several tools that can be used to explore, analyse or manipulate data in an interactive manner. All tools can be found under the "Tools" menu in the main menu bar and some also have buttons in the tool bar.

Actions performed with these interactive tools can not be recorded in protocols and can therefore not be repeated automatically (although some tools, like Crop/Extend Sequence, have analogous operations).

Mouse tools

Selection tool

The Selection Tool can be used to select subsegments ("selection windows") of your sequences and limit the application of some operations to positions within these windows or regions overlapping the windows. To define a selection window, point the mouse at either the start or end of the window within the sequence, press the mouse button and drag the mouse to the other end of the window. Selection windows will be shown as transparent yellow overlays on the sequences. You can define several selection windows by holding down the ALT-key while dragging the mouse (overlapping selection windows will be merged). You can also subtract from the current selections by holding down the SHIFT-key. If you click anywhere within a sequence without holding down either ALT or SHIFT, the current selection windows will be discarded. If you point the mouse at a sequence and press the A-key, the whole sequence will be selected. If you press the I-key, the selection windows in that sequence will be inverted. If you hold down the ALT-key while pressing either A or I, this functionality will be applied to all sequences.


If you have defined at least one selection window and chosen to perform an operation such as e.g. "filter", an additional check box may be shown in the operation dialog which reads "Apply operation only within selected windows" (followed by a specification of the sequence coordinates for these windows). If this option is selected (which it is by default) the application of the operation will be limited to the currently selected segments of the sequences. (See selection windows conditions.)

In MotifLab 2, it is possible to copy the DNA sequence from the selected window(s) of the currently focused sequence to the clipboard by pressing CONTROL+C. The DNA is taken from the topmost DNA Sequence Dataset found in the Features Panel, and if you have selected multiple segments, they will be copied to the clipboard as separate lines.

Move tool

If your sequences span a larger region than can currently fit into the sequence visualization window, you can use the Move Tool to pan the viewport tobring other parts of the sequence into view. Just press the mouse button anywhere inside a track to grab hold of the sequence and drag the mouse to move the sequence viewport left or right. Alternatively, you can use the left and right arrow keys on the keyboard to move the sequence viewport.

Zoom tool

The Zoom Tool can be used to change the visualization scale of a single sequence. Click anywhere inside a track to zoom in at that position or hold down the SHIFT key while clicking to zoom out. (Alternatively, you can zoom out by pressing the middle mouse button, if you have one). You can zoom in on a selected region of the sequence by pressing the mouse button at one end of the region and dragging the mouse to define the region. When you release the mouse button, the viewport will be adjusted to zoom in on the region you selected. You can also zoom in/out at a position by holding down the CONTROL key and using the wheel on your mouse to change the scale. This latter option also works with the Selection Tool, Move Tool and Draw Tool.

Draw tool

The Draw Tool can be used to edit any feature datasets by drawing directly into a track with the mouse.

DNA Sequence Datasets
There are two ways to edit DNA Sequence Datasets with the Draw Tool. The first way is to click on a base in the track with the mouse and then use the keys on the keyboard to type in a new sequence which will overwrite the old one. The new bases are inserted left-to-right in the orientation the sequence is currently shown in. A white cursor is drawn around the base currently being edited (this is easier to see if you zoom in). By default, new bases are entered in uppercase letters, but you can also enter lowercase letters by holding down the SHIFT key. To stop editing, press the ENTER key or move the mousepointer outside of the track (so be careful not to accidentally move the mouse while editing since this could abort the edit prematurely).

The other way to edit DNA Sequence Datasets is to press the mouse button on a base in the track and, while holding the button down, move the mouse up or down to change the base at that position. (Moving the mouse will cycle through the bases A, C, G and T). Moving the mouse sideways will move the cursor so that you can edit other positions as well.
Hold down the SHIFT key to enter lowercase letters instead of the default uppercase letters or hold down CONTROL to insert the non-base letter 'N'. The edit is stopped when you release the mouse button.

Numeric Datasets
To edit a numeric track just press and hold down the mouse button inside the track and move the mouse to draw the new contents. Release the mouse button to finish editing. Moving the mouse outside the track (above or below) while drawing will normally insert the current maximum or minimum value of the track at that position, but you can increase the current numerical range by holding down the SHIFT button while drawing outside the track.

Region Datasets
To add a new region to a region datatrack, press the mouse button on either end of where you want the new region to be and drag the mouse to define the span of the region. If you hold down the CONTROL key when releasing the mouse button, a dialog will appear immediately afterwards to allow you to specify additional properties of the region, such as type, strand orientation and score. You can also edit these properties afterwards by double-clicking on any region with the Selection Tool. (In MotifLab version 1 you must hold down the CONTROL key while double-clicking).
To remove a single region, point at it with the Selection Tool and press the DELETE key on the keyboard, or right-click and select "Delete Region" from the context menu.

Data Browsers

Motif Browser

Documentation in preparation

The Motif Browser tool is also presented in Video Tutorial #3 (part 1).

Module Browser

Documentation in preparation

Sequence Browser

Documentation in preparation

Interactive Analysis Tools

Positional Distribution Viewer

The Positional Distribution Viewer tool can be used to visualize the relative placement of regions across multiple sequences with histograms.
Up to six histograms can be overlaid on top of each other to compare different features.



The region track on which to base the histogram is selected with the drop-down menu on top of the dialog. It is also possible to only consider a subset of the sequences by selecting a Sequence Collection in the second drop-down menu. Only regions that are currently visible in the chosen region track (and sequence subset) will be counted in the histogram, so the tool can be used in combination with other tools, such as e.g. the Motif Browser, to select subtypes of features to be shown. If the "automatic refresh" option is activated (button at the bottom of the dialog), the histogram will be updated automatically whenever the visibility status of regions are somehow changed. If this option is turned off, users must manually press the "Refresh" button in the dialog to update the histogram.

To add a new histogram, simply press one of the six histogram selection buttons to activate it and then change the settings in the dialog and/or update the visibility of regions in the GUI to calculate a new histogram. The histogram is displayed in the color shown on the corresponding button. Although up to six histograms can be shown at the same time, only one of the histograms — the active histogram — is actually updated in response to changes in region visibility.

Press one of the six histogram selectition buttons to activate a histogram and give it "focus". The color of the histogram is reflected on the button. The focused histogram can be updated dynamically to reflect the distribution of the currently visible regions (unfocused ones will not be updated until they are given focus once more). The number on the button of the focused histogram will be shown in white while the unfocused histograms have labels in black. If you press the button of a focused histogram it will be hidden and also loose focus (and the button will no longer be shown in color). Press it once more to show it again. A focused histogram will be updated if the visualization is updated (number of visible regions potentially change) or if any of the settings are changed. Y-scale is normalized so that the height of each histogram bar represents the fractional number of regions falling into that bin relative to the total number of regions in that track.

Sequence alignment mode

In order to derive a histogram, all the sequences are first aligned with each other to find the length of the total sequence span. This span is then divided into the specified number of bins. For example, if the total span is 3000 bp and the number of bins is set to 50, each bin will cover 60 bp. When the alignment mode is Upstream, Downstream or Center, the total span equals the length of the longest sequence. If the alignment mode is TSS (or TES), the length of the total span equals the longest segment upstream of TSS plus the longest segment downstream of TSS (these can belong to two different sequences).

If all the sequences have the same length (and the same relative placement of TSS or TES) the sequence alignment mode makes no difference. Note that unlike most other settings, the alignment mode cannot be changed without invalidating all histograms (inactive histograms will be deleted). So while it is possible to overlay histograms based on different tracks and sequence subsets, or that have different settings for number of bins, alignment anchor and support, it is not possible to overlay histograms that have different sequence alignments.



Bin assignment anchor

When the length of a region spans several consecutive bins, the anchor setting controls which bin(s) the region is assigned to.
This setting has four available options:

  1. Upstream : The region is assigned to the bin spanning the upstream edge of the region
  2. Downstream : The region is assigned to the bin spanning the downstream edge
  3. Center : The region is assigned to the bin spanning the center position of the region
  4. Span : All bins that fully or partially overlap with the region are incremented
The figure below illustrates how the same three regions will be assigned to different bins depending on the anchor setting.

Support mode

When the support option is enabled, the histogram will be based on the sequence support for each bin, i.e. whether or not a sequence has regions that will be assigned to that bin or not. This amounts to merging overlapping regions in a sequence before counting, so each sequence is only counted once for each bin no matter how many regions overlap that bin.


The Positional Distribution Viewer is also presented in Video Tutorial #3 (part 1).

Region Visualization Filters

MotifLab has a very sophisticated sequence and track visualization system, and one of its major strenghts is its ability to dynamically highlight regions of interest either with the use of different colors or by hiding uninteresting regions altogether. An important role in this system is played by Region Visualization Filters that can inspect all the regions in a track and dynamically propose new colors for each individual region (overriding the default colors based on region type). Filters can also decide whether a particular region should be drawn at all. MotifLab keeps a list of all active visualization filters and new filters are added to the end of this list when they are activated. When deciding which color to use for drawing a region, MotifLab queries each filter in order and will use the first non-default color proposed by a filter. When deciding whether to actually draw a region or not, all filters must agree that the region should be visible. If at least one filter insists that the region should be hidden it will not be drawn. Note that general region visibility based on region type is determined before any filters are processed and thus takes precedence. Hence, if you e.g. have selected in the Motifs Panel that motif "M00023" should be hidden, it will not be drawn in a track even if all the active filters says that it should be. (So filters can hide a region that is currently visible but not show a region that is hidden).

MotifLab comes bundled with two interactive tools that utilize the region visualization filtering functionality (Motif Score Filter and Interactions Viewer), but additional filtering tools are available as plugins.

Motif Score Filter / Region Score Filter

The Region Score Filter tool can be used to highlight regions in a track that score above (or below) a dynamically selected cutoff value.



The filter can only be applied to one region track at a time and the target track is selected from the drop-down menu in the upper-left corner of the tool dialog as shown above. The central component in this dialog is the slider that is used to set the score cutoff value. The actual value of the cutoff is displayed in front of this slider. All regions in the target track whose score satisfy the condition set forth by the comparison operator (button behind the slider) are classified as matching regions and the rest are classified as non-matching. Pressing the "Condition operator" button will toggle between the two conditions "above or equal to" ( >= ) and "below or equal to" ( <= ). The "Options" button brings up a menu where you can select how to visualize matching and non-matching regions respectively. The three available options are:
  1. Show matching regions as normal but hide all non-matching regions
  2. Show matching regions as normal but display all non-matching regions in a light gray color
  3. Show matching regions in one color (green) and non-matching regions in a different color (red)
The colors used for matching and non-matching regions with the third option can be changed by clicking on the colored icons in the upper-right corner of the dialog. (They can also be changed through the following display settings : "system.filter.green", "system.filter.red" and "system.filter.lightGray").

Unless otherwise specified, the "score" of each region will simply be based on its regular score property, but it is possible to select a different property from the drop-down menu in the lower-left corner, for instance region length. It is also possible to base the score on a comparison with a numeric track which is selected with the second drop-down menu on the bottom (this menu will not be shown if the selected score property is "score" or "length"). The following score properties are supported:
  1. Score : The normal score property of the region will be used
  2. Length : The score will be the length of the region
  3. Minimum value : The score will be based on the smallest value of the numeric track within the sequence segment covered by the region
  4. Maximum value : The score will be based on the largest value of the numeric track within the sequence segment covered by the region
  5. Average value : The score will be based on the average value of the numeric track within the sequence segment covered by the region
  6. Median value : The score will be based on the median value of the numeric track within the sequence segment covered by the region
  7. Sum value : The score will be based on the sum of values over all positions in the numeric track covered by the region
  8. Center value : The score will be based on the value of the numeric track at the position in the middle of the region
  9. Start value : The score will be based on the value of the numeric track at the first position in the region (direct strand)
  10. End value : The score will be based on the value of the numeric track at the last position in the region (direct strand)
  11. Relative start value : The score will be based on the numeric track value at the first position in the region (relative to the orientation of the sequence)
  12. Relative end value : The score will be based on the numeric track value at the last position in the region (relative to the orientation of the sequence)

The Region Score Filter tool is also presented in Video Tutorial #3 (part 2).

Note: This tool was originally called "Motif Score Filter" in version 1.0 of MotifLab and could then only be used with motif tracks. In version 2.0 the tool was updated so that it could be applied to any region track and the name of the tool was consequently changed to "Region Score Filter".

Interactions Viewer

The "futility theorem" proposed by Wasserman and Sandelin (2014, "Applied bioinformatics for the identification of regulatory elements", Nat Rev Genet, 5:276-287) states that the majority of TF binding sites predicted by motif scanning procedures are likely to be false positives. They are just sites where the DNA sequence happens to bear similarity to some known binding motif, but this motif similarity alone is not enough to make it a functional binding site that play a biological role. However, if you discover multiple binding motifs in close proximity, and these motifs are associated with transcription factors that are known to physically interact with each other, the likehood that all of the sites in the cluster are functional will increase.

The Interactions Viewer is a tool that can highlight such clusters of binding sites for TFs that are known to interact. It has two distinct modes of operation: "Single site" and "Motif types".



Single site mode
In this mode, the user selects a single region in a motif track by clicking on it, and the tool will then highlight other regions nearby associated with motifs for transcription factors that are known to interact with the TF for the region that the user selected, based on the annotated interactions property of the motifs. The region the user selected will be colored black and all other regions – within a specified distance – that can interact with the black region will be colored red. Non-interacting regions will either be hidden or grayed out, depending on the chosen tool settings. It is possible to "cast a bigger net" to capture even more interacting regions by increasing the tool's "level" setting. Level 0 consists of only the region that the user selected (black), while level 1 captures the regions (red color) that can interact with the level 0 region. Each higher level consists of the regions that can potentially interact with any of the regions from the level beneath, so level 2 regions are those that can interact with level 1 and level 3 are those that can interact with any region from level 2, etc..

The figure below shows an interaction network with 4 levels. The user has selected the TATA site in the middle (level 0, black). This TATA motif is known to interact with the PAX2, PAX4 and CDXA motifs that surround it (level 1, red), and these motifs in turn can interact with PBX, TBP and EN1 at level 2 (orange). Also shown are motifs at level 3 (yellow) and level 4 (green). The remaining gray regions are not part of the interactions network.

The colors used for the different levels of the interactions network are:
    Level 0: Black
    Level 1: Red
    Level 2: Orange
    Level 3: Yellow
    Level 4: Green
    Level 5: Cyan
    Level 6: Light blue
    Level 7: Dark blue
    Level 8: Violet
    Level 9: Dark gray
    Level 10 (and above): Gray
These colors will only be used if the "Color by interaction level" option is selected. If this option is not selected, the regions will be shown in their original colors (but non-interacting regions will still be either grayed out or hidden).

When creating the interactions network, the tool works outwards from the single region the user selected. For each new level, only regions that are within a certain distance from the regions in the previous level will be considered. The minimum and maximum distances that define the allowed distance range can either be specified with constant numbers, Numeric Variables or Motif Numeric Maps. With the Numeric Map option, it is possible to define individual distance ranges tailored to each motif type. To also consider overlapping regions, the minimum distance must be set to a negative value.

Interactively clicking on different regions in the track to see if they could potentially be part of local interaction networks can be exiting, but it can also be tedious if you want to check all the regions in a track. For this reason, it is possible to cycle through all the regions in a track, either manually or automatically. To start cycling, first click on a region in the track to start from, and then click on either the "<" or ">" buttons in the tool dialog to jump to the previous or next region respectively. If you click the "(Cycle) Start" button, the tool will automatically advance the selected region after a short time delay. You can then sit back and watch an animation of potential interaction networks in the track. To stop the automatic cycling, either click inside the track or on one of the "<" or ">" buttons in the dialog.

Motif types mode
In this mode, the user selects a group of one or more motifs, and binding sites for these motifs will be shown in black (all instances in all sequences). Other motif sites associated with TFs that are known to interact with the TFs from the selected group will be shown in red. All other regions will be hidden. This mode will only show one level of interactions, but it can do so for multiple target motifs and it does not consider distance constraints.

The Interaction Viewer is also presented in Video Tutorial #3 (part 2).

Sequence Tools

Sort Sequences

The Sort Sequences tool can be used to reorder the sequences in the Visualization Panel with respect to a chosen sort criterion.

Sort propertyEffect
Sequence nameSequences are sorted in natural order according to their names
Sequence lengthSequences are sorted by their lengths
LocationSequences are sorted first by chromosome and then by position within the chromosome
(Visible) Region count†Sequences are sorted according to the number of regions within each sequence with respect to a selected Region Dataset
(Visible) Region coverage†Sequences are sorted according to the number of bases covered by regions within each sequence with respect to a selected Region Dataset
(Visible) Region scores sum†Sequences are sorted according to the sum of region scores over all regions within each sequence with respect to a selected Region Dataset
Numeric mapSequences are sorted according to their values in a selected Sequence Numeric Map
Numeric track sumSequences are sorted according to the sum of values within each sequence with respect to a selected Numeric Dataset
GC-contentSequences are sorted according to their GC-content with respect to a selected DNA Sequence Dataset
MarkThis will place all marked sequences before unmarked ones when sorting in descending order
† These sort modes can optionally consider all regions within a track or only those regions that are currently visible in the Visualization Panel.

The sorting algorithm is stable, so if you first sort by a secondary property (e.g. sequence name) and then by a primary property (e.g. Numeric Map value) the sequences that have the same primary property value (map value) will be sorted internally by the secondary property (name).

Group by Sequence Partition

This option will group sequences together into clusters according to a selected Sequence Partition. The sequences are first sorted by the name of their cluster and within each cluster the sequences are sorted by the chosen sort property.


Note that sorting options are also available from the context menu when right-clicking on a dataset in the Features Panel, and it is possible to sort sequences within a protocol script using the "sort(mode)=asc|desc" display setting command.

Crop Sequences

The Crop Sequences tool can be used to make sequences shorter by removing a number of bases from one or both ends of a sequence.
All existing Feature Datasets will also be updated to conform to the new length.

Cropping can be performed in two different ways:

Removing a specific number of bases

This mode allows you to specify the exact number of bases to remove from the start and the end of the sequences respectively. Note that which side of the sequence is considered the start or end depends on the strand orientation of each sequence but also the selected orientation mode setting. With the "relative orientation" setting, the start of the sequence is the upstream end when oriented according to the origin strand of the sequence. With the "direct orientation" setting, the start will always be the side with the smallest genomic coordinate and the end the side with the largest genomic coordinate.
It is possible to crop a different number of bases from each individual sequence by specifying the number for each sequence in a Sequence Numeric Map and then selecting this map as the argument in the dialog rather than entering a constant number.

Cropping to regions

Provided with a region track, the sequences can be cropped so that the new start of the sequence corresponds with the start of the first region in the selected track and the new end of the sequence corresponds with the end of the last region. In other words, each sequence will be cropped so that it covers all regions present in the track but without additional flanking positions outside. Sequences that contain no regions at all will be left untouched rather than cropping them to 0 bp.


Cropping sequences can also be performed with the operation: crop_sequences.

Extend Sequences

The Extend Sequences tool can be used to make sequences longer by adding new base positions to one or both sides of a sequence.

The tool takes two numeric arguments specifying the number of bases to add to the start of each sequence and the end of each sequence respectively. Note that which side of the sequence is considered the start or end depends on the strand orientation of each sequence but also the selected orientation mode setting. With the "relative orientation" setting, the start of the sequence is the upstream end when oriented according to the origin strand of the sequence. With the "direct orientation" setting, the start will always be the side with the smallest genomic coordinate and the end the side with the largest genomic coordinate.
It is possible to add a different number of bases to each individual sequence by specifying the number for each sequence in a Sequence Numeric Map and then selecting this map as the argument in the dialog rather than entering a constant number.

MotifLab is not able to extend existing Feature Datasets associated with the sequences (since it does not necessarily know the values for these datasets outside the current range and by design refuses to fill in with blanks). Because of this, sequences can only be extended as long as no Feature Datasets are present.

Extending sequences can also be performed with the operation: extend_sequences.

Other Tools

Update Motif Properties

Documentation in preparation




Configuring MotifLab

General options

The general configuration options for MotifLab can be edited in the Options dialog, which can be accessed under "Options..." in the "Configure" menu in the main menu bar. The dialog organizes the options under different tabs.

General

Concurrent Computational Threads

The number of concurrent computational threads can be increased to allow MotifLab to take advantage of parallel processing on computers that have multiple cores (which most computers have these days). Note that this functionality is not fully utilized in the current version of MotifLab (but is used by e.g. the SimpleScanner motif scanning program).

Maximum Concurrent Downloads

This setting specifies how many concurrent download request Motiflab can make to the same server. If this value is set to 1, MotifLab will always wait for any requested file to be completely downloaded before making a new request to the same server. If a value X higher than 1 is specified, MotifLab will have a pool of X connections open simultaneously. Each connection can make a new request to the server as soon as the previous file requested on that connection has been completely downloaded. Allowing more concurrent downloads will normally result in faster download times, but it will also put more strain on the servers (which could potentially result in users being banned from connecting to particular servers).

Network Timeout

The network timeout setting specifies the amount of time (in milliseconds) that a server contacted by MotifLab has to respond before a "network timeout" error will be reported.

Maximum Sequence Length

MotifLab has primarily been designed to perform operations and analyses on multiple, short sequence segments rather than very long (e.g. genome-wide) sequences. The Maximum Sequence Length setting can be used to safeguard against accidentally specifying overly long sequences in the Sequence Dialog (which could for instance happen if a user types a digit or two too many for the end coordinate of a sequence compared to the start coordinate), as this could result in the system being bogged down while attempting to download an excessive amount of data for this sequence region.

TSS at position

In the bioinformatics community it is common to refer to the first base in a gene sequence (the TSS) as position "1" and the second base as "2" (and so on), while the first position upstream of the gene is referred to as "-1". A number line with gene-relative coordinates thus goes directly from the negative numbers (for positions upstream of the gene) to the positive numbers (for positions inside the gene), hence skipping the zero-position. The TSS at position setting can be used to specify whether this particular convention of going directly from -1 to +1 should be followed (by selecting "TSS at position +1") or whether the zero-position should be included (by selecting "TSS a position +0") as with a regular number line.
Note that this setting is used by the Sequence Visualizer (and its ruler and tooltips) but is not necessarily respected by other parts of the system, such as Data Formats that output Region Datasets using TSS-relative coordinates. However, these formats usually have their own parameters that can be used to specify if the +0 position should be skipped.

Autocorrect Sequence Names

This option was introduced in MotifLab version 2.0. MotifLab requires the names of sequences to only consist of letters, numbers and underscores. However, some sequence identifiers, for instance in yeast, can contain other characters as well (hyphens in particular). If the "Autocorrect sequence names" option is selected, MotifLab will automatically convert illegal sequence names to legal sequences names (usually by replacing illegal characters with underscores) whenever data is read from files.

Ask Before Discarding Data

If this option is selected, MotifLab will display a popup dialog whenever one of the "Clear Data" functions is selected from the "Data" menu. The dialog will ask the user to confirm that they really would like to delete the data objects and allow them the chance to change their mind. Also, if a user closes a protocol in the protocol editor or closes an output panel containing contents that has not been saved, MotifLab will ask the user if they would like to save the document before closing it. Note that data that is deleted with the "delete" operation or by selecting a data object and pressing the DELETE key will not be affected by this setting.

Save Session On Exit

This option was introduced in MotifLab version 2.0 and can be set to either "Always", "Ask" or "Never". When set to "Always", MotifLab will always save the current session (to an internal file) when the program is exited and restore this session automatically the next time MotifLab is started. If set to "Ask", MotifLab will display a popup dialog when the program is about to exit which allows the user to choose whether or not to save the current session (and restore it next time). Setting this option to "Never" will disable the auto-save/restore functionality.

Visualization

The "Visualization" tab contains options for configuring how sequences and feature data tracks are displayed in the main visualization panel.

Sequence Window Size

This option will set the width of the sequence windows (displayed tracks), and this can be useful to adjust if you have a computer screen which is either smaller or larger than assumed by the default setup.

Sequence Label Size

This option will set the width of the sequence labels displayed in front of the sequence windows (data tracks). This width can either be set to a fixed size (in pixels) or to a size which is determined by the system based on the size of the label for the sequence with the longest name. The latter option is enabled by checking the scale to fit box (recommended). If a fixed label size (not "scaled to fit") is used and the length of a sequence label is larger than the specified size, the label will be drawn on top of the sequence window (thus obscuring the data tracks displayed underneath).

Antialias text and Antialias motif logos

These two options can be used to turn on or off anti-aliasing on motif logos and text displayed in the sequence window (such as sequence labels, numbers and labels in the ruler and coordinates in the info-panels). Enabling anti-aliasing will allow fonts to be rendered more smoothly than if antialiasing is turned off, which makes the graphics more aesthetically appealing but also easier to read (especially for small font sizes). However, on older computer systems, anti-aliasing would have a performance penalty, which is why these two options were included to turn it off.

Background color

This setting can be used to change the color of the background in the visualization window. The button named "Color" will be displayed in the currently chosen background color, and clicking this button will display a pop-up dialog which allows the user to select a different background color. Clicking the "Reset" button will revert the background color to the default setting (which will be a gray color).

Cache

The "Cache" options tab allows users to turn on or off caching functionality and also clear all the contents of the caches.
Obtaining feature data from external servers could potentially take a long time, which is why MotifLab has options to locally cache data that has been downloaded. Whenever a user requests to obtain data for a certain feature, MotifLab will first check if all or part of the requested data is already available from the local cache, and it will only make connections to external servers in order to obtain data that can not be found in the cache. Also, when users rely on different types of gene identifiers to define which sequence regions to work on, MotifLab will have to contact an external service (usually BioMart) to resolve these gene IDs and determine the genomic coordinates of these sequences. The mapping between gene identifiers and gene locations can also be cached so that this information is readily available for sequences that have been analyzed before. When caching is turned off, no new information will be stored in the cache and MotifLab will not make use of any data that might be present in the cache from before. Turning off caching will not destroy any data presently in the cache, however, so reenabling caching will give access to all data that was previously cached.

Protocol Editor

The "Protocol Editor" options panel can be used to set the colors used for coloring keywords in protocols. The panel contains several colored buttons, including e.g. "Operations", "Data objects", "Data Formats" and "Numbers", that refer to different classes of keywords. The color of each button reflects the color currently used for keywords of that class. To change the color for a particular class, simply press the corresponding button and select a new color from a pop-up dialog.

HTML

The "HTML" panel contains a few options relating to output files in HTML format produced by MotifLab's output operation. HTML documents rely on Cascading Style Sheets (CSS) to define a style for the document (affecting e.g. fonts and colors) and also use JavaScript to enable certain interactive functionality, such as sorting tables by clicking on a column header. The HTML options specify how the required style information and JavaScript code should be made available to the HTML documents.
New FileFor each HTML document in MotifLab that is saved to file, new separate file(s) will be created to hold the style information (or JavaScript code) and these files will be referenced by name from within the HTML-file. A new CSS-style (or JavaScript) file is saved to the same directory as the HTML-file and the name of the file will be the same as the HTML-file except that the suffix is changed to ".css" (or ".js") rather than ".html". Using a new style- or javascript-file for each HTML document allows different documents in the same directory to have different styles and functionalities.
Shared FileWhen this option is selected, the style sheet or JavaScript code is output to a file with a fixed name ("motiflab_style.css" and "motiflab_script.js"), and all HTML documents that are created will contain references to these files (which are assumed to reside in the same directory). When a new HTML-file is saved to a directory which does not contain these files, they will be created. However, subsequent HTML documents saved in the same directory will simply rely on the same files. This means that you can easily change the style or JavaScript functionality for all the HTML-files residing in the same directory simply by editing or replacing the "motiflab_style.css" and "motiflab_script.js" files.
EmbedFor each HTML document created, the code for the CSS style or JavaScript required will be included in the HTML document itself. This means that the HTML documents will be self-contained since they do not rely on other external files (at least if both CSS and JavaScript is embedded).
LinkWhen this option is selected, HTML documents will link to stylesheets and JavaScript files residing on the MotifLab web server. This means that no new stylesheet or JavaScript files are created locally when HTML documents are saved to file, but access to the MotifLab web server would be required in order to display these HTML files properly in a web browser (they can be displayed with default style and no JavaScript functionality, however). Note that linking does not work for CSS style sheets prior to version 2.0 of MotifLab due to a bug.
NoneThis setting specifies that no CSS style information (or JavaScript) should be associated with the HTML document. This would mean that a default style should be used or that functionality requiring JavaScript should be disabled.

The Stylesheet option is used to select which CSS stylesheet to use for HTML documents. Users can choose between a few predefined styles installed with MotifLab or select a homemade CSS-file. To use a predefined style, the name of the style should be typed in brackets in the stylesheet box (e.g. "[green]"). As of MotifLab v2.0, only two predefined styles are available: default and green.


Configuring external programs

XML configuration files for external programs

In order to use external programs within MotifLab, their interfaces must be explained to MotifLab through special configuration files written in an XML-format which is explained below. If you want to check out more examples you can have a look at the configuration files for various supported programs available from the external programs page.

Example:
The box below shows the XML-code required to configure a simple program called "randomfilter.exe" which takes three arguments: the name of a GFF-formatted input-file, a number between 0 and 1.0, and the name of an output-file. The program would read the GFF-file line by line and with a given probability write the line to the new output-file. The command to execute this program from a CLI-shell would be "randomfilter.exe -i <inputfile> -p <inputfile> -o <outputfile>".

  <?xml version="1.0" encoding="UTF-8"?>

  <program name="RandomFilter" class="Filter">

	 <service type="local" location="C:\bioinformatics\randomfilter.exe" />

	 <parameter type="regular" name="Region Track" class="RegionDataset" required="yes">   
	   <dataformat name="GFF" />
	   <argument type="valued option" switch="-i"/>
	 </parameter>

	 <parameter type="regular" name="Probability" class="Double" required="yes">
	   <min>0</min>
	   <max>1.0</max>
	   <default>0.5</default>
	   <argument type="valued option" switch="-p"/>
	 </parameter>

	 <parameter type="result" name="Result" class="RegionDataset" required="yes">
	   <dataformat name="GFF" />
	   <argument type="valued option" switch="-o"/>
	 </parameter>

  </program>

After the compulsory XML-header in the first line follows a <program> element which contains the actual description of the program and its interface.
The <program> element has two arguments: a name and a class. The name argument is just a name selected to refer to the program.
The class argument tells MotifLab what kind of program this is. Five special classes are recognized which can also have specified requirements on the configration file. These are "MotifDiscovery", "MotifScanning", "ModuleDiscovery", "ModuleScanning" and "EnsemblePrediction". Programs from these five classes are executed with corresponding operations in MotifLab; e.g."MotifScanning" programs are executed with the "motifScanning" operation, etc. For programs that do not fall within the special classes, the class argument is merely descriptive and can be set to any value. For example, since the "randomfilter" program above is used to filter data, it is given the arbitrary value "Filter" for the class argument. Programs that are not one of the special classes can be run with the "execute" operation.

A third and optional argument to <program> is cygwin which can take on the values "yes" or "no" (default is "no"). This argument can be used to signal that the program is originally a UNIX/LINUX program and needs Cygwin to be installed in order to run under WINDOWS operating systems. If cygwin is set to "yes" some filepaths might be converted to UNIX-style as necessary.

The <program> element further contains other elements that describe various properties of the program, including information about where the program is located, how to execute it and descriptions of the input and output parameters of the program.

Program properties

The <program> element can contain an optional <properties> element which describes various properties of the program, including names of the authors, a short description of the program itself, contact information, websites and citations. These properties are displayed in the HELP-page for the program (which is shown for instance when the user double-clicks on a program in the External Programs Dialog), and they are mostly useful if one wants to share an XML-configuration file with other users that are not familiar with the program. The <properties> element can also contain a <license> element with a license agreement that the user must accept in order to use the program and a <register> element containing a web address where the user can be directed in order to register their use of the program. HTML-code can be used in the text of these elements as long as the angle brackets used around HTML-elements are escaped (for example, to use italics, "<i>" must be escaped as "&lt;i&gt;").

  <properties>
      <author>Timothy L. Bailey and Charles Elkan</author>
      <citation>
      	Timothy L. Bailey and Charles Elkan (1994)
      	"Fitting a mixture model by expectation maximization to discover motifs in biopolymers",
      	&lt;i&gt;Proc 2nd Int Conf on Intelligent Systems for Molecular Biology&lt;/i&gt;,
      	(28-36), AAAI Press, 1994
      </citation>
      <contact>donotreply@somewhere.org</contact>
      <homepage>http://meme.sdsc.edu</homepage>
      <description>
           MEME searches for novel motifs in DNA (and protein) sequences
           using an expectation maximization strategy
      </description>   
      <register>http://www.server.org/software/register.cgi</register>
      <license>
           In order to use this program you must agree not to use it for commercial purposes
      </license>  
  </properties>

Service type and location

The <service> element describes the program's location and how it should be accessed. The current version of MotifLab only supports use of programs that are installed locally on the user's computer (type="local"), but future versions might also support the use of web services. (The special setting type="bundled" is used for programs that come shipped with the installation of Motiflab). If the location of the executable program is known, it can provided as an argument to the <service> element, as seen in the example for the "RandomFilter" program on top of this page. If the location of the program is not stated in the XML-file, the user must specify the location when the XML-file is installed in MotifLab. If a precompiled executable of the program can be obtained from an external source such as a web server, the location of this source can be provided inside the <service> element using optional <source> elements. The version and os arguments just provide a description for the program source, but the url argument must point to a single file that can be downloaded and "installed" locally by MotifLab. The downloaded file must be executable and usable "as is" since MotifLab is not capable of performing any special installation steps that the program might require. The only processing MotifLab can do is to unzip a program contained within a ZIP file. In this case the argument compression="ZIP" must be set (as shown for the second source below) and the location of the executable file within the ZIP archive must be specified with the targetInZIP argument.

Version 2.0 of MotifLab introduced the require element which can be used to inform the user that this program or configuration file has certain system requirements, for instance that a certain version of JAVA must be installed or that this particular configuration file is only meant to be used with version X of the program in question. These requirements will be shown to the user when the program is configured in MotifLab. A special requirement is "MotifLab version X" which says that this configuration file will only work with a certain version of Motiflab (or more recent versions) since the configuration relies on functionality that is not present in earlier versions. If such a requirement is specified, a user will not be able to configure the program unless the required MotifLab version is used.

   <service type="local">
     <source version="3.1" os="Windows"          
             url="http://homes.esat.kuleuven.be/~thijs/download/windows/MotifScanner.exe" />
     <source version="3.1" os="Windows (mirror)" 
             url="http://tare.medisin.ntnu.no/priorseditor/tools/windows/MotifScanner.zip"   
             compression="ZIP" targetInZIP="bin/MotifScanner.exe" />
     <source version="3.2" os="Linux"            
             url="http://homes.esat.kuleuven.be/~thijs/download/linux_3.2/MotifScanner" />
     <source version="3.2" os="Linux x86-64"
             url="http://homes.esat.kuleuven.be/~thijs/download/linux_x86-64/MotifScanner" />
     <source version="3.2" os="Mac OS X"
             url="http://homes.esat.kuleuven.be/~thijs/download/macosx_ppc/MotifScanner" />
     <require>MotifLab version 2.0</require>
     <require>Java version 1.7</require>
   </service>

Describing the program's interface

The description of the program's command-line interface mostly consists of a list of <parameter> elements, each describing an input or output parameter of the program.
   <parameter type="regular" name="Positional priors" class="NumericDataset"
              required="no" hidden="no">   
       <description>
          A positional priors track (Note: sum of priors for all positions must not exceed 1.0!) 
       </description>   
       <argument type="valued option" switch="-psp"/>
       <dataformat name="PSP">
           <setting name="Orientation" class="String">Direct</setting>
           <setting name="Motif width" class="Integer">8</setting>
       </dataformat>
   </parameter>

Each parameter has a type argument which can be either "source", "result" or "regular". Source parameters refer to existing data objects that are passed on to the external program for processing and result parameters refer to results output by the external program that are read back and converted into new data objects by MotifLab. The five special classes of external programs (motif/module discovery/scanning and ensemble programs) have specific requirements on the number and roles of source and result parameters. For example, motif scanning programs must have exactly one source parameter representing the DNA Sequence track and one result parameter (which must be called "Result") referring to the Region Dataset (motif track) returned my the motif scanning program. Motif discovery programs on the other hand must have two result parameters, which must be called "Result" and "Motifs" respectively, which refer to the motif track and motif collection objects returned by the motif discovery program. Programs can have additional parameters settings besides the input and output parameters which can be used to modify the behaviour of the program. These are then specified as "regular" parameters. Note that "source" parameters are only used by the five special program classes, and other classes should use "regular" parameters also when referring to any data passed on to the external program.

In addition to a type, a parameter must also have a name argument, which is used to refer to the parameter and is also the name displayed in GUI dialogs. Finally, a parameter must have a class argument which specifies the type of data the parameter holds. The class argument can refer to one of the four "basic types" String, Integer, Double and Boolean (for backwards compatibility Double can also be referred to as Float) or to one of MotifLab's own data types. Such data types must then be written without spaces and in camel case (where each "word" begins with a capital letter), such as for instance RegionDataset, MotifCollection and SequenceNumericMap. For Numeric Maps it is also possible to append a plus-sign to the class name. This then taken to mean that a Numeric Variable or literal numeric constant can be chosen by the user instead of a Map when selecting a value for the parameter (e.g. "MotifNumericMap+").

Parameters can have additional optional arguments such as: required, advanced, hidden and skipIfDefault which can be set to either "yes" or "no". Required parameters must be assigned values, and MotifLab will not allow a user to execute a program before he or she has chosen values for all required parameters (non-required parameters can be left blank and rely on defaulting values). Advanced parameters will not be shown in the GUI unless the user explicitly selects to display them by pressing a "+" button. If a program has many parameters, this option can be used to show only the most important parameters and hide the less frequently used parameters (which usually rely on defaulting values anyway) in order to make the visual presentation of the program's settings more tidy. Although not required, it is recommended that all advanced parameters be listed after the non-advanced parameters. Hidden parameters do not show up in GUI dialogs at all, and the user can not change the value of a hidden parameter directly. Hidden parameters can, however, be used to pass default settings to programs and they can also be indirectly updated in a preconfigured way in response to user selections. Arguments that have the skipIfDefault setting on will not be included on the command line if the parameter has the default value (which can be no value for non-required parameters). Unless these optional arguments are specified their default settings will be required=yes, hidden=no, advanced=no, skipIfDefault=yes.

<parameter> elements can contain other elements, for instance an optional <description> of the parameter which can be displayed to the user in a GUI dialog (HTML-code can be used if angle brackets are escaped as explained above).
The <argument> element inside the parameter is required and describes how the parameter is passed to the program. The argument can specify a switch which will preceed the parameter on the command line. Programs that rely on switches usually allow the parameters to be listed in any order on the command line since the switches can be used to identify the parameters. On the other hand, for programs that do not rely on switches, the parameters must be listed in a specific order to correctly interpret the command line. The argument element must specify a type which can be either "valued option", "flag", "explicit", "implicit", "STDOUT" or "STDIN". (The "explicit" type was introduced in MotifLab v2.0.)
Valued option parameters are those that pass some kind of value along to the program. Basic values, such as numbers, simple text strings or Booleans will be output directly on the command line. More complex data objects, on the other hand, will be written to temporary files (in specified file formats) and the name of the file will be referenced on the command line instead. The filename will normally just be some random (but unique) name chosen by the system. However, when it is necessary to use a particular filename, the argument type can be set to explicit rather than valued option and the filename can then be explicitly specified (similar to the last "implicit" parameter in the example below). Flag parameters are used for boolean settings. If the option related to a flag-parameter is selected, the parameter's switch will be output to the command line. If the option is not selected, the parameter will not show up on the command line at all. An implicit parameter will be tied to a specific value which is fixed and already known in advance. The value of this parameter will thus not depend on any current settings selected by the user. Implicit parameters can for example be used to refer to an output-file created by the external program when the name of that file is always the same and not chosen by the user. Some programs will read their input data from STDIN rather than a regular file and/or write output to STDOUT instead of a regular file. The special type values "STDIN" and "STDOUT" can be used to signal that a parameter relies on these standard streams rather than regular files. These types can thus be considered as special cases of implicit parameters. Note that a program can only refer to one STDIN and one STDOUT parameter per command element (explained below).

Example:
The following configuration file is for a program called "scan.exe" which requires a DNA file (in FASTA format) as its first input argument. It is also possible to specify two additional optional arguments, one which specifies a background model (preceeded by the "-b" switch) and one which tells the program to scan the reverse strand rather than the direct strand ("-r" switch). The program then outputs its results to a GFF-file called "output.gff" (this name is hardcoded in the program and is not possible to change).
The command to execute this program from a CLI-shell would then be "scan.exe <fastafile> [-b <background>] [-r]"

  <program name="Scan" class="scanning">
         <service type="local" location="C:\bioinformatics\scan.exe" />

         <parameter type="regular" name="DNA" class="DNASequenceDataset" required="yes">   
           <dataformat name="FASTA" />
           <argument type="valued option"/>
         </parameter>

         <parameter type="regular" name="Background" class="BackgroundModel" required="no">
           <dataformat name="PriorityBackground" />
           <argument type="valued option" switch="-b" switchseparator=" " />
         </parameter>

         <parameter type="regular" name="Scan reverse strand" class="Boolean" required="no">
           <argument type="flag" switch="-r"/>
         </parameter>

         <parameter type="result" name="Result" class="RegionDataset">
           <dataformat name="GFF"/>
           <argument type="implicit" filename="output.gff"/>
         </parameter>

  </program>

Note that the configuration file specifies four parameters but the command line only has three parameters. This is because the last "result" parameter which captures the output from the program refers to a file which is implicit rather than being explicitly mentioned on the command line. When the command line to run this program is created, the parameters will be included in the order they are listed in the configuration. Because of this, the parameter referring to the FASTA file, which the program expects to be the first argument on the command line, must also be the first parameter in the configuration (a later section will describe a different way to construct the command line which foregoes this requirement). The first parameter (called "DNA") refers to a DNA Sequence Dataset object selected by the user. Since this parameter has the "valued option" argument-type, the selected data object will be output to a file (in the FASTA-format specified by the <dataformat> element) and the filename will be included on the command line. (If the class of the parameter had been either Integer, Double, Boolean, String or Numeric Variable its value would have been included directly on the command line).
The second parameter ("Background") is not required and will only be included on the command-line of the user has explicitly selected a Background Model for this parameter. In this case, the Background Model object will be written to a file in "PriorityBackground" format and the filename will be added to the command line after the parameter's specified switch, which in this case is "-b". The optional switchseparator specifies a string used to separate the switch from the parameter's value (in this case the name of the background file) on the command line. The switchseparator defaults to a single space, but is is also possible to specify other separators, for example a colon or an equals sign (in which case the parameter would appear on the command line as "-b:somefilename.bg" or "-b=somefilename.bg").
The third parameter ("Scan reverse strand") refers to a Boolean setting (these are usually displayed as checkboxes in the GUI). Since the argument-type in this case is set to "flag", the switch specified for this parameter ("-r") will only be added to the command line if the Boolean value is TRUE.
The fourth and final parameter ("Result") is a result-type parameter, which means that MotifLab expects to read some file that has been produced by the external program and use the information therein to create a new data object — which in this case should be a Region Dataset. As specified, the file should be in GFF-format. Also, since the argument-type of this parameter is set to be "implicit" the name of this output file is not referenced on the command line. Rather, the filename is specified directly.

Restricting values of simple parameters

Simple parameters such as Integers, Doubles, Strings and Booleans can be given default settings with a <default> element inside the parameter, as can be seen in the example on top of the page for the second parameter (Probability). For number parameters the allowed range can also be specified by providing <min> and <max> elements (although this is not checked in the current version of MotifLab). String parameters can normally take on any value, but they can also be restricted to a limited set of options:
   <parameter class="String" name="Size" type="regular" >   
     <option>Small</option>
     <option>Medium</option>
     <option>Large</option>
   </parameter>
The options are presented to the user who chooses among the allowed values. The value used for the parameter is normally the text between <option> and </option> (here Small, Medium or Large) but it is also possible to specify that a different value should be used. In the example below, the value "S" is used if the user selects "Small", "M" is used instead of "Medium" and "L" instead of "Large".
   <parameter class="String" name="Size" type="regular" >   
     <option value="S">Small</option>
     <option value="M">Medium</option>
     <option value="L">Large</option>
   </parameter>

Specifying the data format for complex parameters

Complex parameters (not simple numbers, Strings and Booleans) are passed to external programs via temporary files. In order to output these parameters to files, the data format to use must be specified with a <dataformat> element inside the parameter. The name of the format must be given and the format might also require specification of additional format-specific <settings>. Each setting has a name and a class class (similar to the class of parameters as described above). Since the data format settings used by an external program is normally decided in advance and hence fixed, the values for the settings are usually constant values written between the <setting> and </setting> tags. However, it is also possible to dynamically set a value using a link to another previously defined parameter (of the same class). For example, the "PSP" data format below specifies values for four settings (if the PSP format had other settings these would take on default values). The first three settings have fixed values, whereas the last setting "Motif width", which is an integer number, takes its value from another parameter called "Motif Size" (which should be an integer-class parameter that has been defined earlier in the XML-file). Please consult the Data Formats section of the user manual for detailed descriptions of each particular data format and their settings.
   <parameter type="regular" name="Positional priors" class="NumericDataset"   
              required="no" hidden="no">   
       <dataformat name="PSP">
           <setting name="Orientation" class="String">Direct</setting>
           <setting name="Normalize"class="String">Max 1</setting>
           <setting name="Include width" class="Boolean">true</setting>
           <setting name="Motif width" class="Integer" link="Motif Size" />
       </dataformat>
   </parameter>


Setting up the command line

The command line used to execute the external program can be defined in two different ways. One way is to explicitly specify the command-line, using the <command> element as described below. This method is the most powerful. However, programs that have very straightforward interfaces can do without the command-element.
If no <command> element is specified, the command-line is build up by writing out the name of the executable program followed by all the parameters in the order that they appear in the XML-file. The values of "simple" parameter types, like numbers and strings are written directly to the command-line whereas complex types (such as large datasets) are written to temporary files and the filename is written to the command line. If a parameter has an associated switch then the switch is written out before the parameter itself. If the parameter is a boolean "flag", only the switch is output (or not, depending on the boolean value of the parameter). "Implicit" arguments are not written to the command line, however. Implicit arguments can be used when the value for a parameter is always the same, for instance if the external program always writes its output to a file named "output.txt" which is not referenced on the command line. Arguments that are implicit should specify the (already known) filename instead of a switch (unless they link to other parameters).

If the "RandomFilter" program described at the top of this page is executed, and the user has chosen a region dataset to use for the first parameter and a value of e.g. "0.45" to use for the second parameter, the resulting command-line that is executed will look like this:
   C:\bioinformatics\randomfilter.exe -i <tempfile_1> -p 0.45 -o <tempfile_2>   

Before executing the command, however, the region dataset the user selected for the first regular parameter is output (in GFF-format) to a temporary file named tempfile_1. The third parameter also refers to a region dataset, but since this is a "result" parameter only the name of the file (randomly chosen for the occasion) is passed to the external program on the command-line. The external program is expected to write its output to this file (in GFF-format as specified in the XML-file) whose contents will later be read back by MotifLab after the program execution has finished.

The command element

If the program requires a more complex command-line than just the name of the program followed by the parameters in the order specified, the command-line can be specified explicitly with a <command> element. For instance, if the RandomFilter program above was not a standalone executable, but rather a perl script, we might have to specify the command-line like this.
   <command>perl %PROGRAM {Region Track} {Probability} {Result}</command>   

Here, %PROGRAM is a special string which refers to the program itself (this was implicit when we didn't use the command-element). Other special strings that can be used include %APPDIR which refers to the directory where the program resides, and %WORKDIR which is the "working directory" used when executing the command. Parameters are referred to on the command line by placing the name of the parameter in braces. The command-line will parsed and these braces will be replaced by the actual value of the parameter (or a filename for complex parameters) possibly preceeded by a switch if one is specified.

It is possible to specify multiple commands that should be executed in succession. This can be useful for instance if there is a need to perform any pre- or post-processing steps before or after running the program itself (for instance to convert output in a non-standard format produced by the program to GFF which can be read by MotifLab). There are two ways to specify multiple commands. The simplest way is to just include multiple commands in the same <command> element and separate those commands with a semicolon. Since some programs or operating systems might use semicolons for other purposes on the command line (for example to separate multiple paths in a JAVA classpath), it is possible to specify alternative characters (or even strings) to separate the commands via a separator argument to the command element. For example, the line <command separator="#"> uses the # sign to separate commands rather than the default semicolon.
The second way to specify multiple commands is to include a list of <command> elements. Note than in order to use this option, this list must be enclosed in an outer <commands> element to signal that the commands belong together.

   <commands>
      <command> first command... </command>   
      <command> second command... </command>   
      <command> third command... </command>   
   </commands>

An XML-configuration file should preferably be designed to be usable irrespective of which operating system the program will eventually run on. However, references to specific files within a command line might be tricky since different operating systems have different ways of representing file paths. Also, some operating systems might need to escape filenames containing spaces by enclosing them in quotes. MotifLab performs the necessary conversions automatically for temporary files and the %PROGRAM special string, but if you want to refer directly to other files within the command line, you might have to explicitly state that this part of the string refers to a file and should be processed accordingly. There are two ways to inform MotifLab that you want to refer to a file, and both work by enclosing the filename in "special quotes". The first uses "dollar-brace" style, like this: ${filepath}$, and the other uses "dollar-quote-brace" style, like so: $'{filepath}'$. (Note that the closing parenthesis is the reverse of the opening parenthesis). The difference between these are really only apparent for programs that run on WINDOWS using CYGWIN. With the first style, WINDOWS-paths are converted to CYGWIN Unix-style paths and enclosed in quotes if they contain spaces. The latter style does not convert the paths but will enclose them in quotes if they contain spaces. Use the latter style to refer to programs that should be executed and the first style for other file references. For an example of usage of the latter style you can have a look at the XML-configuration file for Weeder.

Sometimes, different operating systems can have a totally different command line syntax for the same program. To cope with such cases, you can specify a different command element for each operating system and use the os argument of the command to tell MotifLab which operating system the command pertains to, like so <command os="windows">. The "windows" string can be used to refer to all versions of windows, but for other operating systems the OS-string should match the (case-insensitive) String that will be returned by a call to the JAVA method System.getProperty("os.name"). The os argument also applies to the <commands> element used to group together multiple commands, so you can have different command groups for each OS. If no OS is specified for a command, it will apply to all operating systems and act as the default if no other more specific commands apply (e.g. if a configuration file contains two command elements, one with os="windows" and one with no OS argument, systems running windows will use the windows-specific command and all other systems will use the other command).

There may be cases when programs behave so differently on different operating systems that a simple rephrasing of the command line to execute the program is not sufficient to make the configuration compatible with multiple systems. It could be, for example, that a program has substantially altered functionality depending on the OS, uses different parameters or relies on other data formats for input and output. In such cases the system element can be used to group together elements that apply to different operating systems. A system element should be a direct child of the program element and can contain command, parameter, report and temporary elements that are specific to an operating system. Just like the command element, each system should also have an os argument which specifies which operating system it applies to (and a system element without such argument applies to all operating systems for which no other more specific system element is found).

Linking to other parameters

It is possible for a parameter to take on the same value as another parameter by "linking" to this other parameter. This is accomplished by specifying a link argument containing the name of the target parameter. Note that parameters can only link to other parameters that have already been defined earlier in the XML-file and they can only link to parameters of the same class. Parameters (except result parameters) that link to others should be "hidden", since their values should not be explicitly set by the user (only indirectly via the parameter being linked to). Settings for data formats can also link to other parameters (but not other settings) as explained above, and this is the only way a user can (indirectly) change values for data format settings (since information about data formats used for passing parameters is not usually revealed to the user).
For example, motif discovery programs require two result-type parameters to be defined called "Results" and "Motifs" which will hold respectively the binding sites and motifs discovered by the the program. Each of these parameters is processed individually by MotifLab since the data produced for each parameter could potentially be output to different files by the program (the MotifSampler program for example outputs one GFF-file containing the prediced binding sites and one file containing the motif PWMs). However, many programs output all their results to a single file, and this will require both of these parameters to reference the same file (and usually this also means that a new program-specific parser has to be included in MotifLab). The code below shows these two result parameters defined for a hypothetical motif discovery program ("ProgramX") which allows the name of the single output file to be given on the command line using the switch "-o <outputfile>. The parameter defined first ("Result") references the file on the command line directly by using a "valued option" argument. The second parameter ("Motifs"), however, references the same file by linking to the first parameter (and declaring itself an "implicit" argument). It would be possible to use two different data formats for parsing the results file, one for each parameter. However, the solution below uses the same data format ("ProgramXFormat") for parsing both the binding sites and the motifs in the same file. Instead, the data format-specific setting "Parse" (which can here have the value "Sites" or "Motifs") is used to tell the ProgramXFormat which parts of the information in the file it should concentrate on and also what data it should return to MotifLab.
   <parameter type="result" name="Result" class="RegionDataset"> 
       <argument type="valued option" switch="-o" />
       <dataformat name="ProgramXFormat">
           <setting name="Parse" class="String">Sites</setting>
       </dataformat>
   </parameter>

   <parameter type="result" name="Motifs" class="MotifCollection" link="Result">   
       <argument type="implicit" />
       <dataformat name="ProgramXFormat">
           <setting name="Parse" class="String">Motifs</setting>
       </dataformat>
   </parameter>

Parameters that link to other parameters will either reference the same atomic value as the target parameter (for the basic types Integer, Double, Boolean and String) or reference the same file as the target parameter (for all other complex data types). However, sometimes it could be necessary for a complex-type parameter to reference the same data object as another parameter but to have this object output to a different file in a different format. This can be accomplished by declaring the parameter to be a softlink rather than a regular link. For example, the motif scanning program FIMO can make use of positional priors and therefore has a parameter called "Positional priors" allowing the user to select a Numeric Dataset. This parameter is output in PSP format, but the FIMO program also requires a second auxiliary file based on the same data which should contain binned priors values. Both of these files must be specified on the command line. By using a hidden parameter called "Binned priors" which softlinks to the "Positional priors" parameter, a second file in a different format can thus be created from the same dataset that the user selected for the "Positional priors" parameter.

Conditions  (MotifLab v2.0+)

Sometimes a program can have parameters that are only applicable under certain circumstances, which often depends on the settings of other parameters. For example, if the user has selected a value for an optional parameter, a second parameter might have to be specified also, but this second parameter is not required if the first parameter is unspecified. Hence, for the sake of displaying a tidy user-interface dialog for the program, this second parameter should only be shown to the user after a value has been selected for the first parameter. Such context-specific responses to selections in the dialog can achieved be with conditions. A condition is a child-element of a parameter which is set to monitor a parameter and perform certain actions when the value of this parameter is updated. These actions could include showing or hiding other parameters or setting the value of other parameters.

Example:
Below is an example with an optional parameter called "Background" which has an associated condition monitoring it. When the user selects a value for this parameter, the condition checks if this value is specified (a background model has been selected) or not (the value is left blank). If a background model was selected, a second parameter called "Other" will be shown in the dialog, if not the "Other" parameter will be hidden.
   <parameter type="regular" name="Background" class="BackgroundModel" required="no" > 
       <condition if="selected" then="Other:show" else="Other:hide" />
   </parameter>

Each condition must have an if-attribute which specifies a condition that must be met in order to perform an action. (Alternatively, an ifNot-attribute can be used instead to specify that the action should be performed if the condition is not satisfied). If the if-condition is met (or the ifNot-condition is not met), the then-attribute specifies the action to perform. An optional else-attribute can be used to specify an action that should be performed instead of the then-action if the if-condition is not met.

If-attribute:
The if-attribute can have one of the following values
  • selected
  • value=<allowed values>
  • type=<allowed types>
  • updated
If the if-attribute is set to "selected", the condition will be satisfied if the monitored parameter has a specific selected value (not left blank).
For Boolean parameters this condition is met if the value is TRUE and not FALSE.

If the condition is based on the "value" of the parameter, the condition will be met if this value equals one of the listed values (multiple values can be separated with vertical bars, e.g. "value=1|2|3"). Note that the value that is used is the value of the parameter as it appears in the GUI dialog and not the value of any selected data object. Hence, if the user has selected a Numeric Variable called "X" (with a value of 54) for the parameter, the value that is checked is "X" and not 54. This condition is thus mostly useful for checking the value of String-type parameters.

If the condition is based on the "type" of the parameter, the condition will be met if the data type of the selected value equals one of the listed types (multiple types can be separated with vertical bars). This could, for example, be used to check if the value for an Integer-type parameter was specified with a literal integer ("type=Integer") or with a Numeric Variable ("type=NumericVariable")

The "updated" condition is always met as long as the user has made selections or updates for this parameter in the dialog (even if the selected value is the same as before).

The condition of the if-attribute will usually refer to the value of the enclosing parameter. However, it is possible to specify that the condition should monitor a different parameter instead by specifying the optional monitor="<parameterName>"-attribute (see example below).

Then- and Else-attributes:
These attributes specify an action to perform when the if-condition is met or not met respectively. Recognized values are:
  • show
  • hide
  • setValue=<somevalue>
  • setToValueOf=<parameter>
The "show" and "hide" actions will show or hide the parameter in the dialog, whereas the "setValue" and "setToValueOf" will set the value of the parameter to either a specific value or to the value of another named parameter (note that the latter two should only be employed to set values for hidden parameters that the user has no control over anyway to avoid indeterminate behaviour).
The specified action will normally be applied to the enclosing parameter, but it is possible to apply the action to a different parameter instead by prefixing the action with the name of that parameter followed by a colon (e.g. "OtherParameter:hide" or "OtherParameter:setValue=7").

Note that it is only possible to specify a single action to perform when the condition is met (or not). However, if it is desirable to perform several actions one can always include multiple conditions for a parameter.

Example 2:
This example is equivalent to the example above and shows an alternative way to accomplish the same effect from a different perspective. In the above example, the condition was associated with the "Background" parameter which monitored itself. Depending on the value of this parameter the actions to be performed, as specified by the then- and else-attributes, were applied to a second parameter named "Other" by prefixing the value of the then- and else-attributes with "Other:". In the example below, the condition is instead associated with the "Other" parameter, but the condition is set to monitor the value of the "Background" parameter by setting the monitor="Background" attribute of the condition. Since the actions to be performed when the condition is met (or not) is to be applied to the enclosing parameter ("Other"), the prefix was dropped from the then- and else-attributes.
   <parameter type="regular" name="Other" class="..." required="no" > 
       <condition monitor="Background" if="selected" then="show" else="hide" />
   </parameter>


Reports  (MotifLab v2.0+)

Often a program that writes its regular results to files will output additional information during execution to either STDOUT or STDERR (or both) to inform the user of the program's progress and report on any errors that have been encountered. The standard way to handle such output by MotifLab is to display each line in the GUI's status bar at the bottom of the screen. Version 2.0 of MotifLab, however, introduced the <report> element which can recognize specific expressions and display them either in the status bar, the log panel or an error dialog. If the program outputs information about how far it has come in its execution in the form of a percentage number or ratio, this information can also be captured and used to set the progress bar in the GUI.

  <reports>
      <report expression="" target="status" />   
      <report expression="WARNING:.+" target="log" />   
      <report expression=".*?next.*" target="log" />   
      <report expression="ERROR:.+" target="error" />   
      <report expression=".+?:(\d+)%.*" target="progress" />   
  </reports>

Each <report> element has one required expression argument and two optional arguments target and output. The expression argument specifies a regular expression that MotifLab should look for in the output. If a line sent to STDOUT or STDERR by the program matches a specified expression, that line will be sent to the designated target which can be either "status" (line is displayed in the status bar), "log" (line is displayed in the the log-panel), "error" (line is displayed in an error dialog and the execution of the program is stopped) or "progress". The "progress" target has some special requirements on the regular expression, namely that it must include either one or two capture groups, i.e. expressions enclosed in parentheses that match a number, such as e.g. "(\d+)" in the last example above. If only one capture group is specified, this should match a (percentage) number between 0 and 100 which will be used directly to set the progress in the progressbar. If two such capture groups are specified, the first group should capture a number reporting how many subtasks that have been completed so far and the second group should capture a number reporting the total number of such subtasks (e.g. "processing sequence 23 of 60"). The ratio between the first and second number will then be used to set the progressbar. Note that the specified regular expression must match a whole line in the output by the program and not just a substring. This means that it could be wise to start the expression with ".*?" and end it with ".*" to be sure that the whole line is matched. An empty expression is considered as a wildcard and will match any output. Hence, in the example above, the first report line will display every line of output produced by the program in the status bar, lines starting with the word "WARNING:" or containing the word "next" will be displayed in the log-panel (note that it is possible to specify multiple reports for the same target), and if the program ever outputs a line starting with "ERROR:", MotifLab will end the execution of the program and report this line in an error dialog. The last report statement will search for lines containing any text followed by a colon and an integer number suffixed by a % sign. This integer number will then be used to set the value of the progressbar.
Normally, the line that is matched by the given expression will be displayed to the user. However, it is also possible to state that a different text should be displayed with an optional output argument. For example, the statement "<report expression=".*?next.*" output="still working..." />" will display the text "still working..." in the status bar (which is the default target) every time a line containing the word "next" is output by the running program. So far, the output-text can not contain references to the matched expression, but hopefully this will be supported in future versions of MotifLab.

Cleaning up

If a program creates any additional files or directories during its execution (besides the temporary files created to pass complex parameters), it is prudent to specify these so that MotifLab can perform the necessary clean up after the execution has finished. The <temporary> element is used to specify the names of these temporary files (or directories). The special strings %WORKDIR and %APPDIR explained above can prefix the filenames if necessary.

  <program>
      ...
      ...
      ...
      <temporary filename="tempfile1" />   
      <temporary filename="%WORKDIR/tempfile2" />
  </program>



Configuring data tracks and sources

Datatracks XML configuration file

Documentation is in preparation...


Data Formats

Data formats define ways to formally describe the information contained in a data track or other data object and thus allows this information to be written to files and shared between computational tools. MotifLab supports many of the standard bioinformatics data formats that are relevant to regulatory sequence analysis, including e.g. FASTA, GFF and BED for feature data tracks and TRANSFAC or JASPAR formats for describing motif models. Data objects can be output to a selected data format with the output operation. This operation will create a textual representation of the data according to the specified format and store this text in special Output Data objects (shown as separate tabbed panels in MotifLab).
The contents of such Output Data objects can then be saved to file. Most data formats can be used for both output and input, meaning that information that has been exported in a specific format can be read back by MotifLab at a later time and used to reconstruct the original data objects. However, a few data formats can only be used for either input or output. For example, MotifLab is able to import data from the compressed binary formats BigBED, BigWIG and 2bit, but is currently not capable of exporting data in these formats. Conversely, information about sequences or motifs can be presented in aesthetically pleasing tables in various HTML-based formats, but MotifLab can not parse this information back again to reconstruct the original sequences or motifs.

Complete versus lossy data formats

Data objects usually have a set of recognized standard properties depending on their type. For example, all sequence objects have a genomic location and strand orientation and motifs have names and PWM models (or IUPAC models). All standard data formats that apply to sequences thus have ways to represent the location and strand of a sequence, and data formats used to describe motifs include descriptions of the name and PWM model. However, in addition to such standard properties, data objects in MotifLab often have non-standard or user-defined properties that are not necessarily supported by standard data formats. Hence, if a data object that contains non-standard properties is exported in a standard data format, these non-standard properties will usually be ignored in the output. Consequently, it will not be possible for MotifLab to fully reconstruct the original data object when reading the information back again with such a data format. Below, we use the term complete when referring to data formats that always support the full set of both standard and non-standard properties, and thus allow data objects to be completely reconstructed from files. Users will never risk loosing information if these formats are used. Conversely, lossy data formats do not save all the necessary information required to fully reconstruct the original data object, and these data formats should then be used with some caution. Potentially complete data formats do not save all the information by default, but can be considered complete if necessary precautions are taken.

Below is an incomplete classification of some of the data formats supported by MotifLab
Data Type Complete Potentially complete Lossy
DNA Datasets FASTA
Numeric Datasets PRIORITY PSP2, WIG3, BedGraph3
Region Datasets GFF4, BED1,5, EvidenceGFF1,5, Region_Properties1 GTF
Sequences Location7 Sequence_Properties1, BED1, Properties1
Motifs MotifLabMotif Motif_Properties1, Properties1 TRANSFAC, Jaspar, MEME_Minimal_Motif, INCLUSive_Motif_Model, RawPSSM, XMS, HTML_MotifTable, HTML_Matrix, BindingSequences
Modules MotifLabModule Module_Properties1, Properties1
Collections All applicable formats
Partitions All applicable formats
Maps All applicable formats
Background models All applicable formats6
  1. These formats can specify which properties that should be included. Hence, in order to make them complete, all properties must be specified.
  2. The PSP format can be considered complete only if the "motif width" parameter is set to 0.
  3. MotifLab allows sequences to overlap with other sequences but still be treated as completely separate with respect to the contents of associated feature tracks. For example, if you have two separate sequences A and B that have the exact same genomic location and add e.g. a conservation track, the conservation track will initially be the same for the two sequences. Later, however, the conservation track can be manipulated with operations or edited with the draw tool so that the track has different contents for sequence A and B. Whereas the data formats PRIORITY and PSP will save the track information from a sequence-centric perspective (representing the information as a list of values for each sequence without any consideration to where the sequence is located), the WIG and BedGraph data formats take on a genome-centric perspective and make a note of the genomic position that each value in the track is associated with (without considering which sequence it belongs to). Hence, when importing back information stored in WIG or BedGraph formats, information pertaining to one sequence can overwrite another sequence if they overlap. However, if none of the sequences overlap with each other, these formats can also be considered complete.
  4. GFF is only complete for module tracks if the "include module motifs" parameter is selected. GFF currently does not support tracks with other linked regions.
  5. EvidenceGFF and BED formats are not complete when used with module tracks or linked-region tracks
  6. The "INCLUSive_Background_Model" is the only background model data format that fully supports meta-data, but such meta-data is not fully supported by MotifLab.
  7. Provided that the full "10-field" format or a complete custom-format is used

Default data formats

All data types have an associated default format which is the format used for that data type when no other is specificed (e.g. when executing the command "output DataObject" without a following "in format XXX" argument). The default format is also used when importing data objects specified with data injection.
Data type Default format
DNA Datasets FASTA
Numeric Datasets PRIORITY
Region Dataset GFF
Sequences and Sequence Collections Plain
Motifs and Motif Collections MotifLabMotif
Modules and Module Collections MotifLabModule
Partitions Plain
Maps MapFormat
Background models INCLUSive_Background_Model
Expression Profiles ExpressionProfile

Feature Dataset formats

FASTA


The output for a sequence in FASTA format consists of a header-line followed by one or more lines of sequence data. The header line is distinguished from the sequence data by a greater-than (">") symbol at the start of the line. The word following the ">" symbol is the identifier of the sequence, and this may be followed by additional descriptive text. The sequence data can be split across multiple lines for improved readability, and the sequences will be sorted in the output according to the current sort order.

Example of sequence data in FASTA format:
>ENSG00000035403
GTAGTCGCTGCACAGTCTGTCTCTTCGCCGGTTCCCGGCC
CCGTGGATCCTACTTCTCTGTCGCCCGCGGTTCGCCGCCC
>ENSG00000100345
GCAGATCACCGCGGTTCCTGGGCAGGGCACGGAAGGCTAA
GCAAGGCTGACCTGCTGCAGCTCCCGCCTCGTGCGCTCGC
>ENSG00000107796
AACACCACCCAGTGTGGAGCAGCCCAGCCAAGCACTGTCA
GGGTAAGTGGCGCCAGGCCAAGGATGTGACTTATAGATTC

The header can contain other information in addition to the name of the sequence if the fields are separated by vertical bars. The fields are in order: sequence name, sequence location, strand orientation and organism/genome build. MotifLab version 2.0 can also recognize a fifth field specifying the gene name and location (position of TSS and TES). All the extra fields are optional, but the order is important, so if you want to include information about the strand, you must also include the sequence location field preceeding it.

Example:
>ENSG00000035403|chr10:75425878-75428077|Direct strand|9606:hg18
>ENSG00000035403|chr10:75425878-75428077|Direct strand|9606:hg18|VCL:75427878-75549916

The sequence name must not contain spaces or characters other than letters, numbers or underscores. If the name contains spaces, only the first part of the name will be used. If the name contains other illegal characters, an error will be reported. The location must be given as "chromosome:start-end" (where the "chr" prefix for the chromosome is optional). For the orientation, strings starting with "direct", "+" or "1" are interpreted as the direct strand whereas strings starting with "reverse" or "–" are interpreted as the reverse strand (other strings will just default to direct strand). The "organism/genome build" field should be specified as two values separated by a colon, where the first value is an integer taxonomy identifier (or known organism name) and the second value is the genome build. Optionally, the genome build can be stated alone and the system will then try to infer the organism. The fifth "gene location" field introduced in MotifLab v2.0 is on the form "gene name:TSS-TES".


Arguments
NameDescription
Strand orientation This parameter controls which strand to output for each sequence. Valid options are "Direct" (output sequence from genomic direct strand), "Reverse" (output sequence from genomic reverse strand) and "Relative" (output sequence data relative to the orientation of the sequence. I.e. use same strand as the strand the sequence originates from).
Header Specifies what information to include in the header (after the > sign). The default is to output only the name of the sequence, but additional fields (separated by vertical bars) can also be output, such as the genomic location of the sequence, the strand orientation of the sequence and the genomic build of the sequence.
Column width The number of sequence bases to output on each line. If the length of the sequence is longer than the specified column width, the sequence data will be split across multiple lines. A common value is 80, but the special value of 0 can be used to specify that the whole sequence should be output on one single line.
Extra space If selected, an extra empty line will be added after the sequence data for each sequence (and before the header of the next sequence) to separate the sequences visually. Note that some external programs might not be able to parse FASTA files correctly if extra lines are added.

See also: output, DNA Sequence Dataset


2bit


The 2bit format is a binary format for efficiently storing (multiple) DNA sequences in a compact randomly-accessible format (up to 4Gb). MotifLab is currently able to import DNA track data from 2bit files, but is not able to output tracks in 2bit format. More information about the 2bit format and how to create 2bit files can be found here and here. 2bit formatted files are often used to store entire genomes, and in this case it is possible to extract DNA sequences for any segment as long as the location is known. (In contrast with e.g. FASTA-formatted files where you can only import DNA sequences if they have the same name and length as your current sequence objects)


Arguments
NameDescription
Keep masks If selected, lowercase letters in the DNA sequence will be kept as is ("masked"). If not selected, all bases will be in uppercase.
NOTE: The current implementation of the 2bit format in MotifLab is very inefficient when this option is selected, so it is not recommended to use it.

See also: output, FASTA, DNA Sequence Dataset


WIG


The WIG (wiggle) format is designed for display of dense continuous data such as probability scores. Further description of the WIG format can be found here and here but is also repeated below.
A WIG file consists of one or more blocks where each block starts with a declaration line and is followed by lines defining data elements. There are two main formatting options: fixedStep and variableStep, and each block can have different formatting as described in the block's declaration line. Note that while MotifLab is capable of reading blocks in both of these formats, it will only produce output in variableStep format (with span=1).

variableStep

variableStep format is designed for data with irregular intervals between data points, and is the more commonly used format. It begins with a declaration line, followed by two columns containing chromosome positions and data values.
The declaration line begins with the word "variableStep" and is followed by space-separated key-value pairs:
  • chrom (required) - name of chromosome
  • span (optional, defaults to 1) - the number of bases that each data value should cover
The span allows data to be compressed as follows:

Without span:
variableStep chrom=chr2
300701 12.5
300702 12.5
300703 12.5
300704 12.5
300705 12.5

With span:
variableStep chrom=chr2 span=5
300701 12.5

Both of these examples will display a value of 12.5 at position 300701-300705 on chromosome 2.

fixedStep

fixedStep format is designed for data with regular intervals between data points and is the more compact of the two wiggle formats. It begins with a declaration line, followed by a single column of data values.

The declaration line begins with the word "fixedStep" and is followed by space-separated key-value pairs:
  • chrom (required) - name of chromosome
  • start (required) - start point for the data values
  • step (required) - distance between data values
  • span (optional, defaults to 1) - the number of bases that each data value should cover
Without span:
fixedStep chrom=chr3 start=400601 step=100
11
22
33

Displays the values 11, 22, 33 as single-base features, on chromosome 3 at positions 400601, 400701 and 400801 respectively.

With span:
fixedStep chrom=chr3 start=400601 step=100 span=5
11
22
33

Displays the values 11, 22, 33 as 5-base features, on chromosome 3 at positions 400601-400605, 400701-400705 and 400801-400805 respectively.

Data values

Wiggle element data values can be integer or real, positive or negative. Chromosome positions are 1-relative, i.e. the first base is 1. Only positions specified have data; unspecified positions will be empty.


See also: output, Numeric Dataset


BigWig


The BigWig format is used to represent dense, continuous numeric data in an indexed binary format. BigWig is the most compact and efficient way to represent and access very large numeric datasets, including datasets covering full genomes. MotifLab is currently able to import numeric track data from BigWig files, but is not able to output tracks in BigWig format. More information about the BigWig format and how to create BigWig files can be found here.


See also: output, WIG, Numeric Dataset


BedGraph


The BedGraph format allows display of continuous-valued data in track format. This display type is useful for probability scores and transcriptome data. Further description of the BedGraph format can be found here. This track type is similar to the wiggle (WIG) format and 4-column BED format.
Each line in BedGraph format contains four columns where the first three define a chromosomal region (similar to the first three columns of the BED format) and the last column specifies a numeric value that applies to all the positions within that region.

Example:
chr19 49302000 49302300 -1.0
chr19 49302300 49302600 -0.75
chr19 49302600 49302900 -0.50
chr19 49302900 49303200 -0.25
chr19 49303200 49303500 0.0
chr19 49303500 49303800 0.25
chr19 49303800 49304100 0.50



Arguments
NameDescription
Add CHR prefix If selected, the prefix "chr" will be added before the chromosome number (e.g. chromosome 12 will be output as "chr12" rather than just "12").
Coordinate system Selects whether the coordinates in the are in the standard BED-coordinate system (with the chromosome starting at position 0 and end-coordinates being exclusive) or in the format used by e.g. GFF, where the chromosome starts at position 1 and both start- and end-coordinates are inclusive.

See also: output, WIG, BED, Numeric Dataset


PRIORITY


The PRIORITY format for numeric tracks was originally used by the PRIORITY motif discovery program to describe tracks to use for positional priors. The format is inspired by the FASTA format, and each sequence starts with a header line containing the sequence name preceeded by a greater-than sign (">"). The next line after the header lists values for all the positions in the sequence separated by commas. (However, MotifLab also allows the values to be separated by either spaces or TABs).

Example:
>ENSG00000035403
0.118,0.188,0.839,0.887,0.91,0.898,0.903,0.873,0.0,0.002,0.003,0.001,0.0,0.994,0.996
>ENSG00000100345
0.998,0.999,0.998,0.997,0.997,0.998,0.998,0.982,0.994,1.0,1.0,1.0,1.0,1.0,1.0
>ENSG00000107796
0.444,0.519,0.999,1.0,1.0,1.0,1.0,1.0,1.0,1.0,0.992,0.997,0.994,0.975,0.396



Arguments
NameDescription
Orientation This parameter dictates the order in which to list the values for each sequence. The default setting is "Relative" and the valid settings are:
  • Direct : List values according to the direct genomic strand. I.e. start with the value in the position with the smallest genomic coordinate, followed by the value in the next position with the second smallest genomic coordinate, etc. End with the value in the position with the highest genomic coordinate.
  • Reverse : List values according to the reverse genomic strand. I.e. start with the value in the position with the highest genomic coordinate, followed by the value in the next position with the second highest genomic coordinate, etc. End with the value in the position with the smallest genomic coordinate.
  • Relative : List the values in the order relative to the strand orientation of the sequence itself. I.e. use the "direct" ordering for sequences residing on the direct strand and the "reverse" ordering for sequences on the reverse strand.
  • Opposite : List the values in the order opposite of the strand orientation of the sequence itself. I.e. use the "direct" ordering for sequences residing on the reverse strand and the "reverse" ordering for sequences on the direct strand.
Separator The separator to use between the data values. The default is "Comma", but other valid options are "Space" and "TAB".

See also: PSP, FASTA, output, Numeric Dataset


PSP


The PSP format ("position-specific prior") for numeric tracks is used by programs in the MEME suite to describe tracks to use for positional priors. The format is similar to the PRIORITY and FASTA formats, and each sequence starts with a header line containing the sequence name preceeded by a greater-than sign (">"). The sequence name is followed by a specification of the motif width (W). The next line after the header lists values for all the positions in the sequence separated by spaces. Since the original purpose of the PSP-format was to provide a value for each position reflecting the (prior) probability that a motif of width W could start in that position, the last W-1 positions in each sequence should have the value 0 (since no motifs of width W could start there). In fact, MotifLab will automatically output the value "0.0" for the last W-1 positions, thereby possibly overwriting any previous non-zero values for these positions! The values in a PSP file should preferably be between 0 and 1 and the values in all positions should sum to no more than 1.0 (however, these requirements from the original PSP specification are not enforced by MotifLab).

Example:
>ENSG00000035403 4
0.118 0.188 0.839 0.887 0.91 0.898 0.903 0.873 0.0 0.002 0.003 0.001 0.0 0.0 0.0
>ENSG00000100345 4
0.998 0.999 0.998 0.997 0.997 0.998 0.998 0.982 0.994 1.0 1.0 1.0 0.0 0.0 0.0
>ENSG00000107796 4
0.444 0.519 0.999 1.0 1.0 1.0 1.0 1.0 1.0 1.0 0.992 0.997 0.0 0.0 0.0



Arguments
NameDescription
Orientation This parameter dictates the order in which to list the values for each sequence. The default setting is "Relative" and the valid settings are:
  • Direct : List values according to the direct genomic strand. I.e. start with the value in the position with the smallest genomic coordinate, followed by the value in the next position with the second smallest genomic coordinate, etc. End with the value in the position with the highest genomic coordinate.
  • Reverse : List values according to the reverse genomic strand. I.e. start with the value in the position with the highest genomic coordinate, followed by the value in the next position with the second highest genomic coordinate, etc. End with the value in the position with the smallest genomic coordinate.
  • Relative : List the values in the order relative to the strand orientation of the sequence itself. I.e. use the "direct" ordering for sequences residing on the direct strand and the "reverse" ordering for sequences on the reverse strand.
  • Opposite : List the values in the order opposite of the strand orientation of the sequence itself. I.e. use the "direct" ordering for sequences residing on the reverse strand and the "reverse" ordering for sequences on the direct strand.
Motif width This value (hereafter called W) will be output after the sequence name in the header for each sequence, and the last W-1 values for each sequence will be set to 0.0 (as required by the PSP format).
Include width If selected (default), the motif width parameter will be output after the sequence name in the header. Note that the W-1 values for each sequence will still be set to 0.0 even if the motif width is not included in the header.
Normalize The original PSP specification requires that all the values lie between 0 and 1 and that the sum of values for each sequence is no greater than 1.0. The "Normalize" parameter can be used to normalize all the values so that the output conforms to these requirements. The default setting is to not perform any normalization, but it is also possible to normalize the values by dividing each position with the largest value for each sequence ("Max 1") or by dividing the value in each position with the sum across all positions ("Sum to 1").

See also: PRIORITY, FASTA, output, normalize, Numeric Dataset


GFF


The General Feature Format (GFF) is one of the most popular formats for exchanging information about region based features. The official GFF specification can be found here, but briefly described the format outputs one region per line and each line consists of 8 (or optionally 9) fields separated by TAB.

The fields are in order:
  1. The name of the sequence
  2. The source of the feature
  3. The feature type
  4. The start coordinate of the region
  5. The end coordinate of the region
  6. A score value for the region
  7. The orientation of the region. This can be "+" or "-" (or "." if orientation is unspecified)
  8. The reading frame. The value of this field is either 0, 1 or 2 (or "." if the frame does not apply)
  9. Additional attributes. This optional field consists of a list of attributes separated by semicolon. Each attribute has a key (or "tag") followed by value for the attribute (separated by an equals sign).

NOTE:
When importing regions from a GFF-file, the sequence name in the first column must correspond to the name of an existing sequence in MotifLab, and the region will then be added to that sequence. If the first column contains a chromosome name, it will only be added to a sequence if there is a sequence that is actually named after the chromosome; it is not enough that the sequence covers the chromosomal segment that the region from the GFF-file falls within. When the first column contains chromosome names, it is suggested instead to use the GTF format (or convert the file to BED format).


Sequences output in GFF format are output according to the currently selected sorting order of the sequences, but within each sequence the user can specify whether to sort the regions by position, score or type. The start and end positions of each region (fields 4 and 5) can be output as either genomic coordinates or as positions relative to the start of the sequence by setting the "Position" option to either "Genomic" or "Relative". If the "Relative" setting is chosen, the "Relative-offset" and "Orientation" settings will also apply. The "Relative-offset" setting specifies the coordinate of the first position in the sequence. This will normally be 1 but can be set to other values if needed (for instance 0). The "Orientation" setting specifies which orientation to use to determine the relative region coordinates. For example, if a 100 bp long sequence on the direct strand has a binding site region from position 80 to 90, the start and end coordinates will be [80,90] if the "Direct" strand orientation is selected or [10,20] if the "Reverse" orientation is selected. If the "Orientation" is set to "From Sequence" the strand orientation will be selected based on the orientation of the sequence itself, so that sequences on the direct strand will be output in direct orientation and those on the reverse strand will be output in reverse orientation. If the "Opposite" strand orientation is selected, the orientation will be the opposite of the orientation of the sequence.

If the standard GFF format is not adequate, the "Format" setting can be used to specify an alternative output format. The alternative format is specified by a string consisting of a mix of literal characters and special field codes surrounded by braces (e.g. {START} ). For each region, the field codes in the format string (if recognized) will be replaced by the corresponding value of the field as it applies to the target region before the string is output. Some recognized fields are: SEQUENCENAME, FEATURE, SOURCE, START, END, SCORE, STRAND and TYPE (note the capitalization). TABs can be represented with the escape character \t.

For example, the following output format:
Binding site for {TYPE} at {START}-{END} with score={SCORE} in sequence {SEQUENCENAME}

will produce output that looks like this
Binding site for M00378 at 483-494 with score=5.963 in sequence ENSG00000120948
Binding site for M00253 at 3-10 with score=3.801 in sequence ENSG00000116741
Binding site for M00313 at 8-15 with score=5.697 in sequence ENSG00000116741



Arguments
NameDescription
Position Specifies whether the coordinate positions [start-end] for a region should be given relative to the start of the chromosome ("Genomic"), relative to the upstream start of the sequence ("Relative") or relative to the transcription start site associated with the sequence ("TSS-Relative")
Relative-offset If the "Position" setting is set to "Relative", this offset-value specifies what position the first base in the sequence should start at (common choices are 0 or 1). If the "Position" setting is "TSS-Relative", a value of 0 here will place the TSS at position +0 whereas any other value will place the TSS at position +1 (and the coordinate-system will then skip 0 and go directly from -1 to +1)
Orientation Orientation of relative coordinates (only applicable if the "Position" setting is "Relative").
Sort1,Sort2,Sort3 These three parameters control how to sort the regions in the output. The regions will be sorted first by "Sort1", then by "Sort2" (for regions with similar values for the "Sort1" property) and finally by Sort3. Valid choices for these parameters are "Position", "Type" and "Score" and the three parameters should preferably have different values. The default choice is to first so by "Position", then "Type" and finally "Score".
Include module motifs If selected, the constituent single TF binding sites making up a cis-regulatory module will also be included for each module region. Hence, if a module consists of three TFBS, the module region will be output first on one line followed by three lines containing each of the TFBS regions. The third column in the output will have the value "module" for the module regions and "motif" for the individual TFBS. Also, a "module_identifier" is output on each line that can be used to group together a module entry with its corresponding motif (TFBS) entries.
Skip header lines This (hidden) parameter can be used to specify a number of lines that should be skipped at the start of the file (default is 0). These lines are suspected to contain comments or other information that do not conform to standard GFF format and would therefore result in parsing errors if treated as regular input.
Format The "Format" parameter allows you to specify a different format to use rather than the standard GFF fields. In additional to literal text, the format string can contain field-codes surrounded by braces, e.g. {TYPE}. These field codes will be replaced by the corresponding property value of the region. Standard recognized field codes include: SEQUENCENAME,START,END,TYPE,SCORE,STRAND and ATTRIBUTES. Other field codes can be used to refer to user-defined properties. Tabs can be inserted using \t and extra newlines can be inserted with \n.
Example: Use the following format string to output a comma-separated list with the type of the region plus start and end coordinates in the sequence:
{TYPE},{START},{END}

See also: output, EvidenceGFF, Region Dataset


GTF


The Gene Transfer Format (GTF) is a refined version of the GFF format. More information can be found here and here. The GTF format is rather restricted in MotifLab. The first field ("sequence name") is set to the chromosome ID. The attributes field has two mandatory attributes: gene_id and transcript_id which are set to the name of the sequence and the type of the region.


See also: output, GFF, Region Dataset


EvidenceGFF


The EvidenceGFF format is an extension of the popular GFF format for region based features. The format allows the user to specify a list of additional properties that will be output alongside the standard GFF fields for each region. The additional properties can be output either in semicolon-separated "key=value" format as part of the normal "attributes" field in the standard GFF format or as additional fields separated by TAB (which will then extend the standard GFF format). Which format to use can be selected with the "Evidence format" setting.
The additional properties to output are specified as a string in the "Evidence" setting. This setting should be a list of comma-separated fields in "key=value" format. (Alternatively, the list can be separated by semicolons instead of commas and colons can be used instead of "=" to separate the name of the key from its value).
The "key" can either refer to a known feature dataset or be one of the special keywords region, motif, module, sequence or text.

The proper format of the "value" will depend on the type of the key as described in the table below:

If the key is the special keyword "region" the "value" can refer to any property associated with the region.
Some common region properties are:
type
Will output the type of the region
score
Will output the score value associated with the region
orientation
Will output the orientation of the region: 1 (direct), -1 (reverse) or 0 (undetermined).
In versions 1.05+ the property orientationsymbol or orientationstring will return a plus-symbol (+) for regions in the direct orientation, a minus-symbol (-) for regions in the reverse orientation and a dot (.) for regions with undetermined orientation.
sequence
Will output the DNA sequence spanned by the region (this property is usually only defined for regions in motif tracks)
If the key is the special keyword "motif" the following formats for "value" are recognized:
ID
Will output the name of the motif (usually just an identifier)
short name
Will output a short name for the motif (but usually more descriptive than the ID)
long name
Will output a longer name for the motif
consensus
Will output the consensus binding sequence of the motif
classification
Will output the classification of the motif (based on the type of binding factor)
factors
Will output a list of transcription factors that bind to this motif
In MotifLab version 2 (starting with v2.0.-3), the "value" can refer to any standard or user-defined motif property. Note that the "motif" keyword is only applicable for motif tracks where each region refers to a TFBS with an associated motif. If the region is not associated with a motif, the special code "N/A" will be output.
If the key is the special keyword "module" the "value" can be any standard or user-defined module property.

This feature was added in MotifLab v2.0.-3. Note that the "module" keyword is only applicable for module tracks where each region refers to a known cis-regulatory module type. If the region is not associated with a module, the special code "N/A" will be output.
If the key is the special keyword "sequence" the following formats for "value" are recognized:
(requires MotifLab version 1.05+)
name
Will output the name of the sequence
gene name (or genename)
Will output the name of the gene associated with the sequence (if specified)
species (or organism)
Will output the common name of the organism the sequence originates from
latin species (or latin organism)
Will output the latin name of the organism the sequence originates from
taxonomy
Will output the species taxonomy identifier of the organism the sequence originates from (E.g. for human sequences this will be "9606")
build
Will output the genome build that the sequence originates from
start
Will output the genomic coordinate for the start of the sequence
end
Will output the genomic coordinate for the end of the sequence
chromosome
Will output the chromosome that the sequence resides on
chr
Same as "chromosome" above but with an added "chr" prefix.
orientation
Outputs a plus sign (+) if the sequence is from the direct strand, a minus sign (-) if the sequence is from the reverse strand or a dot (.) if the sequence orientation is unknown.
In MotifLab version 2 (starting with v2.0.-3), the "value" can refer to any standard or user-defined sequence property.
If the key is the special keyword "text" then the corresponding value will be output verbatim.
E.g. the evidence code "text=BindingSite" will output "BindingSite" for every region.
If the key is the name of a DNA Sequence Dataset the following formats for "value" are recognized:
direct
Will output the DNA sequence spanned by the region. The DNA sequence will be from the direct strand.
reverse
Will output the DNA sequence spanned by the region. The DNA sequence will be from the reverse strand.
relative
Will output the DNA sequence spanned by the region. The DNA sequence will be from the strand relative to the orientation of the corresponding Sequence.
If the key is the name of a Numeric Dataset the following formats for "value" are recognized:
minimum (or min)
Will output the smallest value in the interval spanned by the region
maximum (or max)
Will output the largest value in the interval spanned by the region
average (or avg)
Will output the average value in the interval spanned by the region
weighted average (or weighted avg)
Will output the weighted average value in the interval spanned by the region. This value is only defined if the region refers to a binding site for a motif and will default to the normal unweighted average for all other regions. The value of the numeric track in each position is weighted by the normalized information content of the corresponding aligned PWM column of the Motif
median
Will output the median value in the interval spanned by the region
sum
Will output the sum of the values in the interval spanned by the region
weighted sum
The weighted sum of the values in the interval spanned by the region. This value is only defined if the region refers to a binding site for a motif and will default to the normal unweighted sum for all other regions. The value of the numeric track in each position is weighted by the normalized information content of the corresponding aligned PWM column of the Motif
startValue
Will output the value of the numeric track corresponding to the start position of the region (the smallest genomic coordinate)
endValue
Will output the value of the numeric track corresponding to the end position of the region (the largest genomic coordinate)
relativeStartValue
Will output the value of the numeric track corresponding to the position within the region located furthest upstream when viewed relative to the orientation of the Sequence
relativeEndValue
Will output the value of the numeric track corresponding to the position within the region located furthest downstream when viewed relative to the orientation of the Sequence
regionStartValue
Will output the value of the numeric track corresponding to the position within the region located furthest upstream when viewed relative to the orientation of the region
regionEndValue
Will output the value of the numeric track corresponding to the position within the region located furthest downstream when viewed relative to the orientation of the region
centerValue
Will output the value of the numeric track corresponding to the position at the center of the region
If the key is the name of a Region Dataset (hereafter called the "target dataset") the "value" should be in the following format:
        <operator> [qualifiers] <condition> [range] [additional]

The qualifiers field is optional but can contain a space-separated list of keywords as defined below.
The range field is only required when the condition is "within".
The additional field can be added when the operator is "list". Allowed values for this field are described below in connection with the list-operator.

Based on the condition, range and qualifiers, a set of target regions will be obtained from the target dataset.
The following conditions will determine which target regions are included in this set:
overlapping
The set will include those regions from the target dataset that overlap with the region being currently output by EvidenceGFF
inside
The set will include those regions from the target dataset that are fully inside the region being currently output by EvidenceGFF
covering
The set will include those regions from the target dataset that fully cover the region being currently output by EvidenceGFF
within [range]
The set will include those regions from the target dataset that overlap with an interval extending range bases on either side of the region being currently output by EvidenceGFF. The range can be specified as a numeric literal or with a Numeric Variable or Numeric Map.
present
This set will include only those regions from the target dataset that are identical in every way to the region being currently output by EvidenceGFF. This condition is really only useful in statements like "filteredRegions=is present" which will be true if the region being output is also present in the track named "filteredRegions"
The resulting set can be further filtered by requiring the target regions to have additional qualifications:
non-overlapping
Only target regions that do not overlap with the region being currently output by EvidenceGFF will be kept. (This qualifier is really only useful in conjunction with the "within" condition).
interacting   (or "interaction partner")
Only target regions that bind transcription factors known to interact with factors bound by the region being currently output by EvidenceGFF will be kept. (This qualifier is only useful when both the current region and the target region represent TFBS)

After the set of target regions have been obtained based on the condition and filtered based on the selected qualifiers, the choice of operator will determine the final output. EvidenceGFF recognizes the following operators:
is
The final output will be a boolean value (YES/NO, TRUE/FALSE or similar) reflecting whether the set of target regions is non-empty (i.e. whether any target regions met the speficied criteria).
count
The final output will be a numeric value reflecting the size of the set of target regions.
list
The final output will be a comma-separated list of type names for the target regions in the set.
As described above, an [additonal] field may be appended having one of the following values: "with scores", "with distances" or "with scores and distances". When the list of target regions is output "with scores", the score of each target region is written out in parentheses behind the type name of the target region. If the list is output "with distances", the shortest distance from the target region to the region being currently output by EvidenceGFF is written out in brackets [] behind the type name of the target. If the two regions overlap, a distance of -1 will be output.
As of MotifLab v2.0.-3, the value of this field can also be "with [motif | module] <propertyname>" which will output the value of the specified region property within parentheses. The property name can be prefixed with either motif or module to signal that the name instead refers to a property of the motif or module associated with the region.
percentage (or percent). (Requires version 1.05+)
This operator can only be used in combination with the 'overlapping' condition (i.e. "percentage overlapping") and will output the largest fraction of overlap that the currently output region has with any of the target regions.
As of MotifLab v2.0.-3 it is also possible to use "percentage all overlapping" to output a comma-separated list with percentage overlap for every overlapping target region. Note that the order in which these percentages are listed is the same as the order of the regions output with the corresponding "list overlapping" statement.
distance to <qualifier>
The final output will be a numeric value reflecting the distance to the closest qualified target region or the special value "N/A" if no qualified regions could be found. The required qualifier can be "any" (or "closest") which will just output the distance to the closest target region, "interacting" (or "interaction partner") which will output the distance to the nearest region representing a known interaction partner (assuming both regions are motif sites), or it can be the name of a Collection or Text Variable which will output the distance to the nearest region whose type is a member of the Collection or Text Variable. The qualifier "non-overlapping" can also be added to ignore overlapping target regions.

Note that if the "target dataset" is the same as the region dataset being currently output in EvidenceGFF format, the current region being output will never be included in the set of target regions described here.

Examples: (keys are assumed to be referring to known Region Datasets)

 DNaseHS=is overlapping 
Will output YES or NO depending on whether the current region being output overlaps with any regions in the DNaseHS track.

 ChIP_Seq_tags=count covering 
Will output the number of ChIP_Seq_tags that are completely covering the current region being output (so that the current region is fully inside the tag region)

 TFBS=list non-overlapping interacting within 20 with scores and distances 
Will list the type names of TFBS regions that are overlapping an interval extending 20 bp on either side of the current region but not overlapping with the current region itself. The target regions must be associated with motifs that are known to interact with the motif associated with the current region. The score of the target region will be output in parenthesis after its type name and this will be followed by the distance between the target region and the current region in brackets.


For example, the following "Evidence" format:
motif=short name,Conservation=average,Repeats=is overlapping,TFBS=list within 30

will add 4 new fields to the GFF format. The first new field will contain a short name of the motif associated with the region being output. The second field will contain the average value of the "Conservation" track within the interval spanned by the region. The third field will contain a YES or NO value depending on whether or not the region overlaps with a region in the "Repeats" track, and the fourth and last field will contain a list of type names for regions in the "TFBS" track that are within 30 bp of the current region. The output could look something like this:
NTNG1 BindingSites  M00378   48   59  5.963 - . V$PAX4_03   0.109  No   
RPRM  BindingSites  M00253  296  303  3.801 + . V$CAP_01    0.235  Yes  M00313
RPRM  BindingSites  M00313  301  308  5.697 + . V$GEN_INI2  0.0    Yes  M00253,M00315
...



Arguments
NameDescription
Position Specifies whether the coordinate positions [start-end] for a region should be given relative to the start of the chromosome ("Genomic"), relative to the upstream start of the sequence ("Relative") or relative to the transcription start site associated with the sequence ("TSS-Relative")
Relative-offset If the "Position" setting is set to "Relative", this offset-value specifies what position the first base in the sequence should start at (common choices are 0 or 1). If the "Position" setting is "TSS-Relative", a value of 0 here will place the TSS at position +0 whereas any other value will place the TSS at position +1 (and the coordinate-system will then skip 0 and go directly from -1 to +1)
Orientation Orientation of relative coordinates (only applicable if the "Position" setting is "Relative").
Sort1,Sort2,Sort3 These three parameters control how to sort the regions in the output. The regions will be sorted first by "Sort1", then by "Sort2" (for regions with similar values for the "Sort1" property) and finally by Sort3. Valid choices for these parameters are "Position", "Type" and "Score" and the three parameters should preferably have different values. The default choice is to first so by "Position", then "Type" and finally "Score".
Include header If selected, a single header line (starting with #) will be output at the beginning of the output-document. The header contains a specification of all the fields included in the output.
Skip standard fields If selected, the standard GFF fields will not be output, only the evidence fields.
Boolean format This parameter specifies how boolean values should be formatted in the output. Either as "Yes" versus "No" (alternatively "Y" versus "N"), "True" versus "False" (alternatively "T" versus "F") or "1" versus "0".
Evidence format Specifies how the "evidence" should be output for each region. Options are to output each evidence value in a column of its own or to output all evidences in a single column in key=value pairs (separated by semicolons).
Evidence The "evidence" parameter should be a comma-separated list of key=value pairs specifying additional information that should be output for each region. See above for a complete description of recognized evidence codes.

See also: output, GFF, Region Dataset


BED


The BED format consists of one line with TAB separated fields per region in a Region Dataset. The first three fields are required but additional fields can also be specified. MotifLab assumes that files are in a BED-6 format, but it is also possible to use other non-standard formats. The fields of the default BED-6 format are in order:
  1. Chromosome: The name of the chromosome or scaffold.
         (Chromosome names can be given with or without the "chr" prefix)
  2. Chromosome start: Start position of the region in chromosomal coordinates.
  3. Chromosome end: End position of the region in chromosomal coordinates.
  4. Name: The type name of the region.
  5. Score: The score for the region.
  6. Strand: The strand orientation of the region.
         This can be either "+" (direct strand) or "-" (reverse strand), or even "." if the orientation is undetermined.
Note that the default coordinate system employed by the BED format defines the first position of a chromosome to be position 0 (rather than position 1 which is commonly used by other formats), and the end-coordinate of a region is exclusive (i.e. the coordinate is actually the first position after the region).

Example:
chr10   75427001   75427008   M00101   4.9968641726528125   -
chr10   75427002   75427007   M00028   4.686097666202365    +
chr10   75427002   75427007   M00029   4.486802949517       +
chr10   75427003   75427014   M00472   8.447923342601406    -
chr17    8474690    8474701   M00073   7.7850394311299675   +
chr17    8474710    8474718   M00428   6.149151076269675    +
chr17    8474719    8474730   M00507   8.998892822877837    -



Arguments
NameDescription
Add CHR prefix If selected, the prefix "chr" will be added before the chromosome number (e.g. chromosome 12 will be output as "chr12" rather than just "12").
Start position Selects the position of the first base in a chromosome. The default is 0 for BED, but it is usually 1 for other data formats so MotifLab allows the start position to be specified as either 0 or 1.
Coordinate system Selects whether the coordinates in the BED-file are in the standard BED-coordinate system (with the chromosome starting at position 0 and end-coordinates being exclusive) or in the format used by e.g. GFF, where the chromosome starts at position 1 and both start- and end-coordinates are inclusive. This parameter replaces the "Start position" parameter that was used in earlier MotifLab versions.
Format This optional parameter can be used to explicitly define the contents of each line in the BED-file if a non-standard format is used. The format should be defined as a comma-separated list of column names. The default format assumes the BED-file contains the following six columns: "CHROMOSOME, START, END, TYPE, SCORE, STRAND". A line is allowed to contain fewer columns than the format specifies, in which case the missing columns are simply ignored. If the file contains additional columns that the user wants to import, the names of these columns must be included in the format specification. For example, if the file has an additional column containing the property "GeneID" after the STRAND column, the format parameter should be set to "CHROMOSOME, START, END, TYPE, SCORE, STRAND, GeneID". It is also possible to skip columns by replacing the column name with an asterisk (*). For example, if a non-standard BED-file contains the columns "CHROMOSOME, START, END, TYPE, SCORE, GeneID", and a user wants to import all of these properties except for the SCORE property, the format parameter can be set to "CHROMOSOME, START, END, TYPE, *, GeneID" (with SCORE replaced by * in the format definition).

See also: output, Region Dataset


BigBed


The BigBed format can be used to represent region track data in an indexed binary format based on the BED format. BigBed is the most compact and efficient way to represent and access very large region datasets, including datasets covering full genomes. MotifLab is currently able to import track data from BigBed files, but is not able to output tracks in BigBed format. More information about the BigBed format and how to create BigBed files can be found here.


Arguments
NameDescription
Custom fields This optional parameter can be used to declare additional fields in the BigBed file. A BigBed file is required to contain at least three fields which are in order: CHROMOSOME, START and END. If a line contains more than three fields, the next fields must be TYPE, SCORE and STRAND (+/-/.). If a line contains more than these six fields, the rest will be regarded as custom fields. MotifLab can read these custom fields and add their values to the region as user-defined properties, but to do that the fields must be identified by supplying a comma-separated list of property names. For example, if the Custom fields parameter is set to "count,gene", each entry in the BigBed file is expected to have (at least) 8 fields where the 7th field is named "count" and the 8th field is named "gene". If the name of a custom field is set to "*" it will be ignored. Thus, if the Custom fields parameter is set to "*,gene", the value in the 7th field will be ignored but the value in the 8th field will be added to the region as a user-defined property named "gene".

See also: output, BED, Region Dataset


Region_Properties


The Region_Properties data format allows users much freedom in customizing their own format for Region Datasets by specifying which properties of the regions they want to include in the output. The data format will either output all the regions from one sequence on the same line or output only one region per line. In the first case, the line will start with a chosen description of the sequence followed by descriptions of all the regions in that sequence. In the second case, each line will start with the sequence description followed by one region, and the sequence description will thus be repeated for every region at every line.

Example of regions output (one on each line) with the Sequence format string "{sequencename}" and Region format "{type} ({motif:short name})\t{sequence:chromosome string}:{genomic start}-{genomic end} [{orientation string}] => {sequence}"
ENSG00000035403   M00428   (V$E2F1_Q3)   chr10:75427729-75427736   [Direct] => TTTGGCGG
ENSG00000035403   M00048   (F$ADR1_01)   chr10:75427746-75427751   [Direct] => TGGGGC
ENSG00000035403   M00028   (I$HSF_01)    chr10:75427761-75427765   [Direct] => CGAAA
ENSG00000100345   M00344   (P$RAV1_02)   chr22:35113793-35113804   [Direct] => CTCACCTGAACC
ENSG00000100345   M00428   (V$E2F1_Q3)   chr22:35113815-35113822   [Reverse] => GTTCCCGG
ENSG00000100345   M00497   (V$STAT3_02)  chr22:35113817-35113824   [Reverse] => CTGTTCCC
ENSG00000100345   M00029   (F$HSF_01)    chr22:35113818-35113822   [Direct] => GGAAC
ENSG00000173531   M00482   (V$PITX2_Q2)  chr3:49701607-49701617    [Direct] => TGTCATCCCAG
ENSG00000173531   M00500   (V$STAT6_02)  chr3:49701617-49701624    [Reverse] => ACCTTCCC
ENSG00000173531   M00048   (F$ADR1_01)   chr3:49701652-49701657    [Direct] => AGGGGT
ENSG00000173531   M00378   (V$PAX4_03)   chr3:49701653-49701664    [Reverse] => TACCTCCACCCC
ENSG00000173531   M00048   (F$ADR1_01)   chr3:49701657-49701662    [Direct] => TGGAGG



Arguments
NameDescription
Layout This parameter controls the general layout of the output. The two available choices are "one sequence per line" (which will output selected information about the sequence followed by selected information about every region within that sequence) and "one region per line" (which will output information on only one region per line, preceeded by information about its parent sequence).
Sequence format This parameter specifies the information to output for each sequence. In additional to literal text, the format string can contain property codes surrounded by braces, e.g. {CHROMOSOME}.
These property codes will be replaced by the corresponding property values of the sequence in the output. Some standard property codes include SEQUENCENAME, START, END and STRAND. See the documentation for the "Sequence_Properties" data format for a comprehensive list of standard sequence properties. Note that names of standard properties are case-insensitive but the names of user-defined properties are case-sensitive. Use the escape character \t to insert a tab and \n to insert a line break. If you leave the field empty it will take on the default value, but you can set it to * (single asterisk) to signal that the field should not be output at all. Note that leading or trailing whitespace in the format string will be ignored, but you can use the escape character \s to represent spaces instead.
Tip: If you don't want to output sequence properties at the beginning of the line but rather mix these in between the other region properties, set the sequence format to * (empty) and use property codes prefixed with "sequence:" in the Region format parameter.
Region format This parameter specifies the information to output for each region. In additional to literal text, the format string can contain property codes surrounded by braces as explained for the Sequence format parameter above.

Standard region properties include:
  • type
  • score
  • orientation   (or "strand". The absolute orientation of the region)
  • relative orientation   (The orientation of the region relative to the parent sequence. +1 if they are the same or -1 if they are opposite)
  • orientation sign
  • orientation string
  • relative orientation sign
  • relative orientation string
  • sequence   (This is the sequence of DNA bases associated with the region)
  • start
  • end
  • relative start
  • relative end
  • genomic start
  • genomic end
  • size
  • chromosome   (or just "chr" for short. The chromosome number or letter(s))
  • chromosome string   (or "chr string". Same as above but prefixed with 'chr')
  • TSS-relative start
  • TSS-relative end
  • TES-relative start
  • TES-relative end
In addition to these region properties, you can also include properties of the parent sequence by prefixing the property name with "sequence:". For example, to output the chromosome of the sequence you can use the property code {sequence:chr}. If the region represents a motif site (the type of the region is the name of a motif), you can also refer to properties of this motif by prefixing the property name with "motif:". For example, to output the information content of the motif associated with the region, use the code {motif:IC-content}. Similarly, if the region is a module site, you can output module properties by prefixing with "module:". See the other data formats "Sequence_Properties", "Motif_Properties" and "Module_Properties" for more information on standard properties of these data types.

Use the escape character \t to insert a tab and \n to insert a line break in the format string. If you leave the field empty it will take on the default value, but you can set it to * (single asterisk) to signal that the field should not be output at all. Note that leading or trailing whitespace in the format string will be ignored, but you can use the escape character \s to represent spaces instead.

A note on coordinate systems:
The "start" and "end" properties will output the start (and end) position of the region relative to the start of the parent sequence on the direct strand. The relative start and end properties outputs these positions relative to the beginning of the parent sequence, which in this case will be strand dependent. The genomic start and end properties outputs positions relative to the start of the chromosome (as long as the genomic location of the parent sequence is known). The TSS/TES-relative properties will output the start and end relative to the position of the TSS/TES of the gene associated with the parent sequence.

All of these coordinate systems start at position 0 except for genomic coordinates which start at 1. If you want these positions to start at 1 instead (or 0 for genomic coordinates) you can explicitly add [0] or [1] after the property name, e.g.: {relative start[1]}, {genomic start[0]} or {TSS-relative start[1]}.

1-indexed coordinates relative to TSS/TES work a little bit different than regular coordinate systems since the TSS/TES will be placed at +1 but the immediate upstream position will be called -1. This, in effect, will skip the 0-position: ..., -3, -2, -1, +1 [TSS], +2, +3, ... This choice will affect the positive coordinates of regions downstream of TSS/TES (or regions spanning TSS/TES) but not the negative coordinates of upstream regions.
Sequence delimiter The delimiter text that separates the sequence information from the region information. The default is a TAB (\t). If you leave the field empty it will take on the default value, but you can set it to * (single asterisk) to signal that the delimiter should be empty. Note that leading or trailing whitespace in the string will be ignored, but you can use the escape character \s to represent spaces instead.
Region delimiter The delimiter text that separates the information of different regions. This only applies when multiple regions are output to the same line. The default is a TAB (\t). If you leave the field empty it will take on the default value, but you can set it to * (single asterisk) to signal that the delimiter should be empty. Note that leading or trailing whitespace in the string will be ignored, but you can use the escape character \s to represent spaces instead.

See also: output, Sequence_Properties, Motif_Properties, Module_Properties



Motif formats (and module formats)

MotifLabMotif


The MotifLabMotif format is the default format for motifs used by MotifLab, and it is currently the only format that will include information about all the properties related to a motif (and not just the identifier and matrix). The format is basically a direct extension of the INCLUSive Motif Model format but with additional #-fields describing both standard and user-defined motif properties such as the name of the transcription factor (#Short and #Long), the transcription factor class (#Class), binding factors (#Factors), the organisms the TFs are expressed in (#Organisms), motifs for known interacting factors (#Interactions) and alternative motifs models for the same TFs (#Alternatives). A file in MotifLabMotif format must start with a header line reading "#MotifLabMotif" which serves to identify the format.

Example:
#MotifLabMotif (inspired by INCLUSive Motif Model v1.0)
#
#ID = M00002
#Short = V$E47_01
#Long = E47 (E2A immunoglobulin enhancer binding factor)
#W = 15
#Class = 1.2.1.0
#Factors = E47
#Organisms = human (Homo sapiens)
#Interactions = M00001,M00002,M00058,M00065,M00066,M00068,MA0048,MA0081,M00454,MA0092
#Alternatives = M00065,M00066,M00071,M00222,MA0091
#Transfac class = C0010
4.0    4.0    3.0    0.0
2.0    5.0    4.0    0.0
3.0    2.0    4.0    2.0
2.0    0.0    9.0    0.0
0.0    11.0    0.0    0.0
11.0    0.0    0.0    0.0
0.0    0.0    11.0    0.0
1.0    2.0    8.0    0.0
0.0    0.0    0.0    11.0
0.0    0.0    11.0    0.0
0.0    0.0    4.0    7.0
1.0    4.0    3.0    3.0
1.0    6.0    2.0    2.0
1.0    4.0    4.0    2.0
1.0    4.0    2.0    3.0

#ID = M00001
#Short = V$MYOD_01
#Long = MyoD (myoblast determination gene product)
#W = 12
#Class = 1.2.2.0
#Factors = MyoD,MyoD (376 AA),MyoD (275 AA)
#Organisms = chick (Gallus gallus),rat (Rattus norvegicus),human (Homo sapiens)
#Interactions = M00001,M00002,M00004,M00006,M00222,M00223,M00225,M00231,M00232
#Alternatives = M00184
#Transfac class = C0010
1.0    2.0    2.0    0.0
2.0    1.0    2.0    0.0
3.0    0.0    1.0    1.0
0.0    5.0    0.0    0.0
5.0    0.0    0.0    0.0
0.0    0.0    4.0    1.0
0.0    1.0    4.0    0.0
0.0    0.0    0.0    5.0
0.0    0.0    5.0    0.0
0.0    1.0    2.0    2.0
0.0    2.0    0.0    3.0
1.0    0.0    3.0    1.0



Arguments
NameDescription
Include non-standard fields If selected, information about non-standard, user-defined motif properties will also be included.
Include derived fields If selected, motif properties that are derived from other properties, such as GC-content, IC-content and IUPAC consensus string (all derived from the matrix representation), will also be included in the output.
Include color info If selected, information about the current colors used for the motifs in MotifLab will also be included in the output. When a file containing color information is imported into motiflab, the motifs will be assigned their specified colors. If an imported motif file does not contain color information, the motifs will be assigned arbitrary colors.

See also: INCLUSive_Motif_Model, output


MotifLabModule


The MotifLabModule format is the default format for modules used by MotifLab, and it is a variation of the MotifLabMotif format. A file in MotifLabModule format must start with a header line reading "#MotifLabModule" which serves to identify the format, and this is followed by a description of the modules (and optionally also the single motifs involved in these modules).

Each new module is introduced with the line:
#ModuleID = <unique identifier>

This is followed by a list of the motifs involved in the module:
Motifs = <comma-separated list of "module motif" names>

Note that the "module motif" names in the mentioned list are not single motif identifiers referencing Motif objects, but rather descriptive motif names that are internal to the module (the "module motif" names must be unique within the module). Each such "module motif" can be represented by multiple single motif objects, as described by lines in the following format:
Motif(<module motif>) = <list of Motif identifiers>

Additional constraints regarding the motifs within the module can also be specified, for example the maximum length of the module:
MaxLength = <maximum number of base pairs the module can span>

Whether the motifs in the module must appear in the order they are listed in the "Motifs = " line or if they can appear in any order.
Ordered = <true|false>

The module motifs might also have specific orientations relative to each other.
Orientation(<module motif>) = <Direct|Reverse>

Or constraints on the distance between pairs of consecutive motifs in ordered modules.
Distance(<module motif 1>,<module motif 2>) = [<min distance>, <max distance>]


Example:
#MotifLabModule
#
#ModuleID = MOD0001
Motifs = STAT,GATA
Ordered = false
MaxLength = 200
Motif(STAT) = M00225,M00492,M00493,M00494,M00500,M00496
Motif(GATA) = M00351,M00350,M00076,M00203,M00077,M00075,M00347,M00346

#ModuleID = MOD0002
Motifs = SRY,AP1
Ordered = true
MaxLength = 200
Motif(SRY) = M00160,M00148
Motif(AP1) = M00041,M00172,M00039,M00517,M00040,M00113,M00114,M00174,M00115
Orientation(SRY) = Direct
Orientation(AP1) = Reverse

#ModuleID = MOD0003
Motifs = STAT,ER,MYC
Ordered = true
MaxLength = 200
Motif(STAT) = M00225,M00492,M00493,M00494,M00500,M00496,M00497,M00498
Motif(ER) = M00191
Motif(MYC) = M00055,M00322,M00006,M00005,M00007
Orientation(STAT) = Direct
Orientation(ER) = Reverse
Distance(STAT,ER) = [5,10]
Distance(ER,MYC) = [0,16]



Arguments
NameDescription
Include single motifs The single motifs listed in the "Motif(x)=..." lines must reference Motif objects that are already known to MotifLab. It is possible to include descriptions for the motifs involved in the modules in a MotifLabModule file, so that the file will contain everything that is needed to restore the modules on import. The motif descriptions will be appended after the module descriptions at the end of the file in MotifLabMotif format.
Include module color info If selected, information about the current colors used for the modules in MotifLab will also be included in the output. When a file containing color information is imported into motiflab, the modules will be assigned their specified colors. If an imported module file does not contain color information, the modules will be assigned arbitrary colors.

See also: INCLUSive_Motif_Model, output


INCLUSive_Motif_Model


The following description of the INCLUSive_Motif_Model format is taken directly from the MotifSuite web site.

The file must start with a comment line which identifies the format (#INCLUSive Motif Model v1.0).
Next follows the PWM description of a first motif, starting with some comment lines. The first comment line describes a unique motif identifier (#ID). The second comment line shows a motif score (#Score) which can be a score that is computed from the PWM or any other score that reflects the importance of the motif being described. The following two lines give the PWM length (#W) and a consensus description (#Consensus) of the motif. A consensus description is derived from the information available in the PWM; it is a string-based sequence representation of the motif in IUPAC code symbols (A,C,G,T,n,s,w) that describes the most likely nucleotide(s) on each position in the motif (n = any of A,C,G,T, s = C or G, w = A or T. Note that MotifLab can use additional IUPAC codes as well).

The comment lines are immediately followed by the values that make up the PWM (matrix) : each line describes the tab-separated probabilities (Pr) for nucleotide A, C, G and T on a given position in the motif. The number of lines must equal the length of the motif (#W). The probabilities described in a PWM can be frequencies (normalized values between 0 and 1 and the sum of a row equals 1), or they can be represented as counts (values can be higher than 1 and zeros are also common).
MARK : decimal numbers in a PWM must be described using a DOT (not a comma) e.g. 0.54 (not 0,54).

        Pr(A,1)     Pr(C,1)     Pr(G,1)     Pr(T,1)
        Pr(A,2)     Pr(C,2)     Pr(G,3)     Pr(T,4)
        ...
        Pr(A,W)     Pr(C,W)     Pr(G,W)     Pr(T,W)

The motif description ends with a blank line return. The second and following motifs are described in exactly the same way, each time separated from each other by a blank line. The end of the file is recognized by the last blank line return. Note that there is no explicit numbering of the motifs in the file.

Example:
#INCLUSive Motif Model v1.0
#
#ID = M00001
#W = 12
#Consensus = srACAGGTGkyG
1.0    2.0    2.0    0.0
2.0    1.0    2.0    0.0
3.0    0.0    1.0    1.0
0.0    5.0    0.0    0.0
5.0    0.0    0.0    0.0
0.0    0.0    4.0    1.0
0.0    1.0    4.0    0.0
0.0    0.0    0.0    5.0
0.0    0.0    5.0    0.0
0.0    1.0    2.0    2.0
0.0    2.0    0.0    3.0
1.0    0.0    3.0    1.0

#ID = M00002
#W = 10
#Consensus = GGGGCGGGGT
2.0    1.0    6.0    2.0
3.0    1.0    6.0    1.0
0.0    0.0   11.0    0.0
0.0    0.0   11.0    0.0
0.0    8.0    2.0    1.0
3.0    0.0    6.0    2.0
0.0    1.0    7.0    3.0
1.0    0.0    8.0    2.0
1.0    2.0    7.0    1.0
3.0    2.0    0.0    6.0



See also: output


RawPSSM


RawPSSM will output motifs in a FASTA-inspired format where the entry for each motif starts with a header consisting of the motif identifier preceeded by a greater-than sign (">"), and this header is followed by the matrix representation for the motif output as either a 4xN or Nx4 matrix (depending on the chosen orientation).

Example (in "Horizontal" orientation):
>M00001
2   3   0   0   0   3   0   1   1   3
1   1   0   0   8   0   1   0   2   2
6   6  11  11   2   6   7   8   7   0
2   1   0   0   1   2   3   2   1   6

>M00002
1   2   3   0   5   0   0   0   0   0   0   1
2   1   0   5   0   0   1   0   0   1   2   0
2   2   1   0   0   4   4   0   5   2   0   3
0   0   1   0   0   1   0   5   0   2   3   1



Arguments
NameDescription
Format If the "Default" format is selected, the matrix will be output exactly as it is represented in each motif (which can be either a count matrix, a frequency matrix or a log-odds matrix). However, if the "Frequencies" format is selected, all matrices will be converted to frequency matrices before being output.
Orientation The orientation can either be "Vertical" or "Horizontal". If a "Vertical" orientation is selected, the matrix will consist of four columns corresponding to each of the bases A, C, G and T and it will have N rows (where N is the length of the motif). If a "Horizontal" orientation is selected, the matrix will consist of four rows corresponding to each of the bases and the matrix will have N columns (one for each position).
Delimiter Specifices the character used to separate the columns in the matrix. The default delimiter is "Tab", but other choices are "Space", "Comma" and "Semicolon".
Header Specifies which information to include in the header for each motif. The possible options are: include only the motif ID ("ID"), include both the motif ID and motif name (short name) separated with a space ("ID Name") or include both the motif ID and motif name separated with a hyphen ("ID-Name").

See also: output


TRANSFAC


In the TRANSFAC motif format each line starts with a field code consisting of two characters and this is usually followed by a value for the field. The double slash code "//" is used to separate different motifs from each other in the file, and a double X (XX) is used to separate different fields. Some fields that can have multiple values can be repeated on consecutive lines in the file. The following field codes are recognized by MotifLab:
  • AC : This field will map to the motif identifier.
  • ID : This field will map to the "short name" of the motif.
  • NA : This field will output a cleaned up version of the "short name"of the motif (stripped of prefixes and suffixes) but is not used for input.
  • DE : This field will map to the "long name" of the motif.
  • BF : This field can contain the name of a TF binding to the motif and the organism in which this happens. This field is used for input to populate the "binding factors" and "organisms" properties of the motif, but it is not used for output.
  • P0 : This code marks the start of the matrix field
The matrix representation of the motif follows immediately after the "P0" code. Each matrix line has six columns where the first column is the position in the matrix, the next four columns contain matrix values for A, C, G and T respectively and the last column contains an IUPAC consensus symbol for that position.

Example:
VV  TRANSFAC MATRIX TABLE
XX
//
AC  M00001
XX
ID  V$MYOD_01
XX
NA  MYOD
XX
DE  MyoD (myoblast determination gene product)
XX
P0      A      C      G      T
01      1      2      2      0      S
02      2      1      2      0      R
03      3      0      1      1      A
04      0      5      0      0      C
05      5      0      0      0      A
06      0      0      4      1      G
07      0      1      4      0      G
08      0      0      0      5      T
09      0      0      5      0      G
10      0      1      2      2      K
11      0      2      0      3      Y
12      1      0      3      1      G
XX
//
AC  M00002
XX
ID  V$E47_01
XX
NA  E47
XX
DE  E47 (E2A immunoglobulin enhancer binding factor, also known as Transcription factor 3 (TCF3))
XX
P0      A      C      G      T
01      4      4      3      0      V
02      2      5      4      0      S
03      3      2      4      2      N
04      2      0      9      0      G
05      0     11      0      0      C
06     11      0      0      0      A
07      0      0     11      0      G
08      1      2      8      0      G
09      0      0      0     11      T
10      0      0     11      0      G
11      0      0      4      7      K
12      1      4      3      3      N
13      1      6      2      2      C
14      1      4      4      2      N
15      1      4      2      3      N
XX
//



See also: output


Jaspar


The motif format used by the JASPAR database is a FASTA-inspired format where the entry for each motif starts with a header consisting of the motif identifier preceeded by a greater-than sign (">"), and this header is followed by a 4xN matrix representation of the motif where each row is enclosed in brackets and the row is preceeded by the corresponding base letter.

Example:
>M00001
A  [1 2 3 0 5 0 0 0 0 0 0 1 ]
C  [2 1 0 5 0 0 1 0 0 1 2 0 ]
G  [2 2 1 0 0 4 4 0 5 2 0 3 ]
T  [0 0 1 0 0 1 0 5 0 2 3 1 ]

>M00002
A  [ 4  2  3  2  0 11  0  1  0  0  0  1  1  1  1 ]
C  [ 4  5  2  0 11  0  0  2  0  0  0  4  6  4  4 ]
G  [ 3  4  4  9  0  0 11  8  0 11  4  3  2  4  2 ]
T  [ 0  0  2  0  0  0  0  0 11  0  7  3  2  2  3 ]



Arguments
NameDescription
Format If the "Default" format is selected, the matrix will be output exactly as it is represented in each motif (which can be either a count matrix, a frequency matrix or a log-odds matrix). However, if the "Frequencies" format is selected, all matrices will be converted to frequency matrices before being output.
Header Specifies which information to include in the header for each motif. The possible options are: include only the motif ID ("ID") or include both the motif ID and motif name (short name) separated with a space ("ID Name").

See also: output


XMS


XMS is an XML-based format for specifying motifs and collections of motifs used by NestedMICA.

Example:
<motifset>
  <motif>
    <name>M00799</name>
    <weightmatrix alphabet="DNA" columns="7">
        <column pos="0">
            <weight symbol="adenine">0.0</weight>
            <weight symbol="cytosine">1.0</weight>
            <weight symbol="guanine">0.0</weight>
            <weight symbol="thymine">0.0</weight>
        </column>
        <column pos="1">
            <weight symbol="adenine">0.9523809523809523</weight>
            <weight symbol="cytosine">0.0</weight>
            <weight symbol="guanine">0.0</weight>
            <weight symbol="thymine">0.047619047619047616</weight>
        </column>
        <column pos="2">
            <weight symbol="adenine">0.0</weight>
            <weight symbol="cytosine">1.0</weight>
            <weight symbol="guanine">0.0</weight>
            <weight symbol="thymine">0.0</weight>
        </column>
        <column pos="3">
            <weight symbol="adenine">0.0</weight>
            <weight symbol="cytosine">0.09523809523809523</weight>
            <weight symbol="guanine">0.8571428571428571</weight>
            <weight symbol="thymine">0.047619047619047616</weight>
        </column>
        <column pos="4">
            <weight symbol="adenine">0.0</weight>
            <weight symbol="cytosine">0.0</weight>
            <weight symbol="guanine">0.047619047619047616</weight>
            <weight symbol="thymine">0.9523809523809523</weight>
        </column>
        <column pos="5">
            <weight symbol="adenine">0.047619047619047616</weight>
            <weight symbol="cytosine">0.0</weight>
            <weight symbol="guanine">0.9047619047619048</weight>
            <weight symbol="thymine">0.047619047619047616</weight>
        </column>
        <column pos="6">
            <weight symbol="adenine">0.0</weight>
            <weight symbol="cytosine">0.38095238095238093</weight>
            <weight symbol="guanine">0.38095238095238093</weight>
            <weight symbol="thymine">0.23809523809523808</weight>
        </column>
    </weightmatrix>
  </motif>
</motifset>



See also: output


MEME_Minimal_Motif


The MEME_Minimal_Motif format is primarily used by programs from the MEME Suite. The original format specification can be found here.

The format contains the following sections:
  1. Version (required)
  2. Alphabet (recommended)
  3. Strands (optional)
  4. Background frequencies (recommended)
  5. Motifs (required)
For each motif in the motifs section there are the sub-sections:
  1. Motif name (required)
  2. Motif letter-probability matrix (recommended*)
  3. Motif log-odds matrix (optional*)
  4. Motif URL (optional)
*Note that at least one of the two starred sections is required. MotifLab can read motifs in both "letter-probability" and "log-odds" formats (the data read from the file is stored directly in the motif matrix) but will only output motifs in "letter-probability" format.

A file in MEME Minimal Motif format must start with the MEME version line which looks like this:
MEME version <version number>
This line is required to identify the file as a MEME Minimal Motif file. MotifLab will always output "4" as the version number.

The alphabet line specifies what alphabet to expect the motifs to be in. For DNA motifs this line will be
ALPHABET= ACGT

The strands line indicates if motifs were created from sites on both the given and the reverse complement strands of the DNA sequences.
strands: <which strands>
The <which strands> can be replaced with "+" to indicate only the given strand and "+ -" to indicate both strands. MotifLab will always output "+ -".

The background frequencies describe how prevalent each letter of the motif alphabet was in the source sequences which were used to create the motifs. Programs in the MEME Suite use this background to convert between motif letter-probability matrices and log-odds matrices. For DNA alphabets the format is as follows:
Background letter frequencies
A <A-frequency> C <C-frequency> G <G-frequency> T <T-frequency>
The four frequencies should sum to 1.0. MotifLab will always output uniform background frequencies (0.25 in each case).

A motif name line indicates the start of a new motif and designates an identifier for it which much be unique to the file. It also allows for an (optional) alternate name which does not have to be unique.
MOTIF <identifier> <alternate name>

The letter probability matrix is a table of probabilities where the rows are positions in the motif and the columns are letters in the alphabet. The columns are ordered alphabetically so for DNA the first column is A, the second is C, the third is G and the last is T. As each row contains the probability of each letter in the alphabet the probabilities in the row must sum to 1. If this section is not specified then the log-odds matrix must be specified.
letter-probability matrix: alength= <alphabet length> w= <motif length> nsites= <source sites> E= <source E-value>
... (letter-probability matrix goes here) ...

All the "key= value" pairs after the "letter-probability matrix:" text are optional. The "alength= alphabet length" and "w= motif length" can be derived from the matrix if they are not specified, provided there is an empty line following the letter probability matrix. The "nsites= source sites" will default to 20 if it is not provided and the "E= source E-value" will default to zero. The source sites is used to apply pseudocounts to the motif and the source E-value is used for filtering the motifs input to some MEME Suite programs.


Example
MEME version 4

ALPHABET= ACGT

strands: + -

Background letter frequencies
A 0.303 C 0.183 G 0.209 T 0.306 

MOTIF crp
letter-probability matrix: alength= 4 w= 19 nsites= 17 E= 4.1e-009 
 0.000000  0.176471  0.000000  0.823529 
 0.000000  0.058824  0.647059  0.294118 
 0.000000  0.058824  0.000000  0.941176 
 0.176471  0.000000  0.764706  0.058824 
 0.823529  0.058824  0.000000  0.117647 
 0.294118  0.176471  0.176471  0.352941 
 0.294118  0.352941  0.235294  0.117647 
 0.117647  0.235294  0.352941  0.294118 
 0.529412  0.000000  0.176471  0.294118 
 0.058824  0.235294  0.588235  0.117647 
 0.176471  0.235294  0.294118  0.294118 
 0.000000  0.058824  0.117647  0.823529 
 0.058824  0.882353  0.000000  0.058824 
 0.764706  0.000000  0.176471  0.058824 
 0.058824  0.882353  0.000000  0.058824 
 0.823529  0.058824  0.058824  0.058824 
 0.176471  0.411765  0.058824  0.352941 
 0.411765  0.000000  0.000000  0.588235 
 0.352941  0.058824  0.000000  0.588235 

MOTIF lexA
letter-probability matrix: alength= 4 w= 18 nsites= 14 E= 3.2e-035 
 0.214286  0.000000  0.000000  0.785714 
 0.857143  0.000000  0.071429  0.071429 
 0.000000  1.000000  0.000000  0.000000 
 0.000000  0.000000  0.000000  1.000000 
 0.000000  0.000000  1.000000  0.000000 
 0.000000  0.000000  0.000000  1.000000 
 0.857143  0.000000  0.071429  0.071429 
 0.000000  0.071429  0.000000  0.928571 
 0.857143  0.000000  0.071429  0.071429 
 0.142857  0.000000  0.000000  0.857143 
 0.571429  0.071429  0.214286  0.142857 
 0.285714  0.285714  0.000000  0.428571 
 1.000000  0.000000  0.000000  0.000000 
 0.285714  0.214286  0.000000  0.500000 
 0.428571  0.500000  0.000000  0.071429 
 0.000000  1.000000  0.000000  0.000000 
 1.000000  0.000000  0.000000  0.000000 
 0.000000  0.000000  0.785714  0.214286 



See also: output


Motif_Properties


The Motif_Properties format will output a table with one motif on each row and with columns containing information about different motif properties chosen by the user. In MotifLab v2.0+ this format can also be used to import motif collections.

Example of properties output with the format string "ID,Short name,Classification,Consensus" (with header)
#ID      Short name   Classification   Consensus
M00006   V$MEF2_01    4.4.1.1          CTCTAAAAATAACyCy
M00005   V$AP4_01     1.3.1.4          wGAryCAGCTGyGGnCnk
M00008   V$SP1_01     2.3.1.0          GGGGCGGGGT
M00007   V$ELK1_01    3.5.2.0          nAAACmGGAAGTnCGT
M00002   V$E47_01     1.2.1.0          vsnGCAGGTGknCnn
M00001   V$MYOD_01    1.2.2.0          srACAGGTGkyG
M00004   V$CMYB_01    3.5.1.1          nCnrnnGrCnGTTGGkGG
M00003   V$VMYB_01    3.5.1.1          AATAACGGnA



Arguments
NameDescription
Format This parameter specifies which motif properties to include in the output as an ordered, comma-separated list of property names. Note that standard properties are case-insensitive, but user-defined properties are case-sensitive!

Standard motif properties include:
  • ID
  • Short name
  • Long name
  • Consensus
  • Size
  • IC-content
  • GC-content
  • Factors
  • Classification
  • Class name
  • Quality
  • Part
  • Alternatives
  • Interactions
  • Organisms
  • Expression
  • Matrix

When importing motifs from an existing file, the format parameter should list the properties in the order they appear in the file. If the file contains more properties than you want to import, you are allowed to specify only a subset. For example, if the file has the following five properties ID, Short name, Consensus, Quality and Organisms (in that order), and you only want to import the first three, you can just set the format parameter to "ID, Short name, Consensus" and the remaining properties will simply be ignored. You can also skip properties in the middle of the list by replacing the property name with an asterisk. To import only the properties ID, Consensus and Organism from the mentioned file (i.e. only columns 1,3 and 5), set the format parameter to "ID,*,Consensus,*,Organisms". If the file contains a "header" in the first line (starting with # and describing all the properties), you can use this header rather than naming the properties explicitly by setting the format parameter to a single asterisk (*). Note that the ID property must always be included or MotifLab will complain.
Separator This parameter specifies how to separate the motif properties on each line in the output. The character chosen as the separator will replace the commas in the format string above. Valid options for the separator are "TAB" (default), "Comma", "Semicolon", "Colon" and "Vertical bar".
List-separator Some motif properties may be represented by lists (e.g. binding factors and alternative motif models). The "List-separator" parameter specifies how to separate the entries in such lists. Valid options are "Comma" (default), "TAB", "Semicolon", "Colon" and "Vertical bar". Note that this separator should be different from the separator used to separate the motif properties that are output.
Header If this option is selected, a header line starting with # will be included at the beginning of the output. The header line describes which motif properties are included.

See also: output, HTML_MotifTable, Module_Properties, Sequence_Properties, Properties


Module_Properties


The Module_Properties format will output a table with one module on each row and with columns containing information about different module properties chosen by the user.

Example of properties output with the format string "ID, Size, Max IC, Motifs" (with header)
#ID      Size   Max IC                Motifs
MOD0040    3    43.5204389330021      NFKAPPAB65,SP1,EGR2
MOD0078    3    54.12787872722569     STAT,TITF1,STAT3
MOD0081    3    39.159961609322714    P300,STAT,IRF7
MOD0069    6    95.6314848710252      AP1FJ,STAT,AP1,CREBP1CJUN,STAT1,STAT3
MOD0070    4    76.28839485773265     STAT,IRF1,STAT1,ISRE
MOD0101    2    42.324578249877625    NRSE,MTATA
MOD0105    2    38.59871626791364     PAX5,MTATA



Arguments
NameDescription
Format This parameter specifies which module properties to include in the output as an ordered, comma-separated list of property names. Note that standard properties are case-insensitive, but user-defined properties are case-sensitive!

Standard module properties include:
  • ID
  • Cardinality (or: Size)
  • Consensus
  • Motifs
  • Ordered
  • Oriented
  • Max length
  • Min IC
  • Max IC
Separator This parameter specifies how to separate the module properties on each line in the output. The character chosen as the separator will replace the commas in the format string above. Valid options for the separator are "TAB" (default), "Comma", "Semicolon", "Colon" and "Vertical bar".
List-separator Some smodule properties may be represented by lists (e.g. GO-terms). The "List-separator" parameter specifies how to separate the entries in such lists. Valid options are "Comma" (default), "TAB", "Semicolon", "Colon" and "Vertical bar". Note that this separator should be different from the separator used to separate the module properties that are output.
Header If this option is selected, a header line starting with # will be included at the beginning of the output. The header line describes which module properties are included.

See also: output, Motif_Properties, Sequence_Properties, Properties, HTML_ModuleTable


HTML_MotifTable


The HTML_MotifTable format will output an HTML-formatted table with one motif on each row and with columns containing information about different motif properties chosen by the user. It is possible to include graphical sequence logos for the motifs and also specify alternative motif properties to be shown as tooltips when the user points at a cell in the table.


Arguments
NameDescription
Format This parameter specifies which motif properties to include in the output as an ordered, comma-separated list of property names. Note that standard properties are case-insensitive, but user-defined properties are case-sensitive!

Standard motif properties include:
  • ID
  • Short name
  • Long name
  • Consensus
  • Size
  • IC-content
  • GC-content
  • Factors
  • Classification
  • Class name
  • Classpath
  • Quality
  • Part
  • Alternatives
  • Interactions
  • Organisms
  • Expression
  • Matrix
  • Logo
The name of a property can be followed by the name of another property within parenthesis. This second property will be displayed as a tooltip when the mouse is over the table cell with the first property. For example, the format string: "ID,Short Name(Long Name)" will create a table with two columns where the first column will contain the motif ID and the second the motif's short name. If the user points the mouse at the short name of a motif, its long name will be displayed in a tooltip. (Note that this might not work within MotifLab but should work if the HTML document is saved to a file and displayed in an external web browser).
Sequence logo height The height of the sequence logos (if logos are included).
Sequence logo width The maximum width of sequence logos. If this is specified, logos will be scaled to fit within this limit when necessary. A value of 0 means no limit.
Sequence logos Specifies whether the image files for motif sequence logos should be made specifically for this output data object and given file names reflecting this fact ("New images") or if the image files should be named after the motifs themselves (e.g. "M00134.gif") and allowed to be shared by other HTML-formatted output data objects that also contain sequence logos for the same motifs ("Shared images").
multiline Some motif properties may be represented by lists (e.g. binding factors and alternative motif models). If the "multiline" option is selected, these lists will be broken across multiple lines in a table cell. If the "multiline" option is not selected, these properties will be output as comma-separated lists.
Headline An optional headline which will be displayed above the table.

See also: output, Motif_Properties


HTML_ModuleTable


The HTML_ModuleTable format will output an HTML-formatted table with one module on each row and with columns containing information about different module properties chosen by the user. It is possible to include graphical logos for the modules and also specify alternative module properties to be shown as tooltips when the user points at a cell in the table.


Arguments
NameDescription
Format This parameter specifies which module properties to include in the output as an ordered, comma-separated list of property names. Note that standard properties are case-insensitive, but user-defined properties are case-sensitive!

Standard module properties include:
  • ID
  • Cardinality
  • Motifs
  • Ordered
  • Oriented
  • Max length
  • Max IC
  • Min IC
  • Logo
The name of a property can be followed by the name of another property within parenthesis. This second property will be displayed as a tooltip when the mouse is over the table cell with the first property. For example, the format string: "ID,Logo(Max IC)" will create a table with two columns where the first column will contain the module ID and the second a graphical module logo. If the user points the mouse at the logo for a module, its maximum IC will be displayed in a tooltip. (Note that this might not work within MotifLab but should work if the HTML document is saved to a file and displayed in an external web browser).
Logo max width The maximum width of module logos. If this is specified, logos will be scaled to fit within this limit when necessary. A value of 0 means no limit.
Logos Specifies whether the image files for module logos should be made specifically for this output data object and given file names reflecting this fact ("New images") or if the image files should be named after the modules themselves (e.g. "MOD0003.gif") and allowed to be shared by other HTML-formatted output data objects that also contain logos for the same modules ("Shared images"). A third option is to output logos using textual rather than graphical representations ("Text").
multiline Some module properties may be represented by lists. If the "multiline" option is selected, these lists will be broken across multiple lines in a table cell. If the "multiline" option is not selected, these properties will be output as comma-separated lists.
Headline An optional headline which will be displayed above the table.

See also: output


BindingSequences


This format can be used to create motifs based on lists of individual binding sequences provided in a FASTA-like format. The definition of each motif should begin with a header consisting of a greater-than sign followed by the motif ID, e.g. ">M0001". The motif ID should begin with a letter and only consist of letters and numbers. A name ("short name") for the motif can be provided after the motif ID following any non-word character (such as a space or a hyphen). The header should be followed by a set of binding sequences for the motif (one sequence on each line). Note that all the binding sequences for the same motif must have equal lengths, and they can only consist of the letters A,C,G or T (or U can be used instead of T). However, rather than specifying a list of binding sequences, it is possible to state a single consensus motif which is then allowed to include IUPAC symbols for degenerate bases.

When the format is used for output, it will output a header-line for each motif followed by a list of all the binding sequences associated with that motif. If the motif has no annotated binding sequences, it can either output an IUPAC consensus sequence or, optionally, a set of randomly generated binding sequences that taken together will approximate the base frequencies of the motif binding matrix to a given precision.

Example:
>Motif1 E-box
CACGTG
CAgGTG
CACGTG
CACGTG
CcCGTG
CACGaG
CACGTG

>Motif2
nrATGAyvTA

>Motif3 Unknown
AGCTACT
AGCTAGT
GGCTAGT
AGCTAGT
aGCTACT
AGCTAGT
AGCTAGG

#Motif with separate headers for each binding sequence
>Motif4-1
AGCTACT
>Motif4-2
AGCTAGT
>Motif4-3
GGCTAGT
>Motif4-4



Arguments
NameDescription
Binding sequence property This parameter specifies the name of the user-defined motif property that contains (or will contain) the binding sequences as a comma-separated list. If no property is specified when importing motifs from file, the binding sequences will not be stored together with the motif. If no property is specified when outputting motifs, the consensus sequence (or a set of randomly generated sequences) will be output rather than the actual binding sequences.
Header Specifies which information to include in the header for each motif. The possible options are: include only the motif ID ("ID") or include both the motif ID and motif name (short name) separated with a space ("ID Name").
Separate headers If this option is selected, each binding sequence will be preceded by a separate header on the previous line. These headers will be similar to the regular headers except that the motif ID will be immediately followed by a hyphen and an incremental number.
When missing This parameter controls what to output when a motif does not have any annotated binding sequences associated with it.
  • The option "Output consensus" will output a single IUPAC consensus sequence which is based on the frequency matrix of the motif. The rules for using different letters are in order: a single base letter (A,C,G,T) is used if the frequency of that base in a position is at least 50% and also double the frequency of any other base. A double-degenerate letter (m,r,w,s,y,k) is used if the combined frequencies of two bases are at least 75%. A triple-degenerate letter (b,d,h,v) is used if one of the bases has a frequency of zero. If none of the previous rules apply, the wildcard letter 'n' will be used.
  • The option "Generate random" will output a set of randomly generated binding sequences that taken together will recreate the frequencies of a motif's binding matrix (to a given precision), so if you output a set of motifs to file using this option and then import them back again, their binding matrices will be exactly or approximately the same. If the binding matrix of a motif is a count matrix (i.e. it only contains integer numbers), the number of binding sequences output will be equal to the sum of base counts for one position (all positions should sum to the same value!). The numbers from the matrix will be directly related to the binding sequences output, so if the matrix has a count of 3 for base 'A' in position 5, exactly 3 of the binding sequences output will have an 'A' in the fifth position. Thus, the original count matrix can in theory be exactly recreated from these binding sequences; however, MotifLab will always generate frequency matrices when importing motifs in BindingSequences format. If the binding matrix of a motif is not a (consistent) count matrix, the matrix will first be converted into a count matrix by multiplying the normalized frequency values with a given factor (which is a power of 10) and rounding to the nearest integer (with some corrections if necessary). The binding sequences will then be generated as for a regular count matrix.
Random sequences precision This advanced parameter controls the number of sequences that will be randomly generated if the "When missing" parameter is set to "Generate random" and the binding matrix of a motif is a frequency matrix (or log-transformed matrix) rather than a count matrix. The value N (between 1 and 6) of this parameter is directly related to the number of sequences output (=10^(N-1)) and hence also the number of decimals (N-1) used for the frequencies if a frequency matrix is recreated from these binding sequences.

See also: output



Background formats

PriorityBackground


The following description of the PriorityBackground format is taken directly from the PRIORITY user manual.

The background model's order (k) may be any integer between 0 and 5. For a k-th order model the file must contain exactly 4 + 4^2 + 4^3 + ... + 4^(k+1) real numbers between 0 and 1, with one number on each row.

For example for a 3rd order model the numbers represent:

   P(A) 
   P(C)
   P(G)
   P(T)
   P(A|A)
   P(C|A)
   P(G|A)
   P(T|A)
   P(A|C)
   ....
   P(T|T)
   P(A|AA)
   P(C|AA)
   .....
   P(T|TT)
   ......
   P(T|TT)
   P(A|AAA)
   P(A|AAC)
   .......
   P(A|TTT)
   ........
   P(T|TTT)


In this case the file must contain 4+16+64+256=340 numbers.

IMPORTANT!!! Notice that every group of 4 consecutive numbers must add up to 1 to form a probability distribution.


See also: output


MEME_Background


The following description of the MEME_Background format is taken directly from the MEME Suite web site.

The format for n-order Markov background models is as follows.

The file must contain one line for each combination of 1, 2, ..., n-1 letters in the alphabet. The DNA alphabet is ACGT.

Each line must contain the letter combination followed by the letter combination's frequency (probability). All other lines in the file are ignored, including comment lines starting with '#'.

For example, a 0-order Markov model file might contain:
# tuple   frequency_non_coding
a       0.324
c       0.176
g       0.176
t       0.324

A 1st-order Markov model file might contain:
# tuple   frequency_non_coding
a       0.324
c       0.176
g       0.176
t       0.324
# tuple   frequency_non_coding
aa      0.119
ac      0.052
ag      0.056
at      0.097
ca      0.058
cc      0.033
cg      0.028
ct      0.056
ga      0.056
gc      0.035
gg      0.033
gt      0.052
ta      0.091
tc      0.056
tg      0.058
tt      0.119



See also: output


INCLUSive_Background_Model


The following description of the INCLUSive_Background_Model format is taken directly from the MotifSuite web site.

The file starts with a comment line which identifies the format (#INCLUSive Background Model v1.0).
Next follows a description of the order of the background model (#Order) and two informational fields describing respectively a genome identifier (#Organism) and the path referring to the sequences data where the model is extracted from (#Sequences).

The single nucleotide frequencies for A,C,G,T are described by 4 tab separated values (between 0 and 1) on the line following #snf. They represent the probability (Pr) to find the respective nucleotide in the sequence dataset where the background is modelled for, independent of the position of this nucleotide in the sequences.

        #snf
        Pr(A)     Pr(C)     Pr(G)     Pr(T)

The section following #oligo describes the probability of all possible combinations of the nucleotides A,C,G,T of length equal to the background model order (also called an oligonucleotide) in the sequence dataset where the background is modelled for. The total number of oligonucleotides are printed on separate lines and equals 4 powered to the background model order (e.g. 16 for a second order model). The section starts with the oligonucleotide consisting of all A, followed by oligonucleotides where each next position in the oligonucleotide A is repeatedly replaced by respectively C,G,T. Below example is for a second order background model.

        #oligo
        Pr(AA)
        Pr(AC)
        Pr(AG)
        Pr(AT)
        Pr(CA)
        Pr(CC)
        Pr(CG)
        Pr(CT)
        Pr(GA)
        Pr(GC)
        Pr(GG)
        Pr(GT)
        Pr(TA)
        Pr(TC)
        Pr(TG)
        Pr(TT)

The higher-order background model is described in the section following #transition matrix. Each line in this section describes the tab separated probabilities (Pr) of finding nucleotide A respectively C, G and T given a set of preceding nucleotides of length equal to the background model order. The total number of lines equals 4 powered to the background model order. The preceding oligonucleotide for the first line consists of all A, and in next lines A is repeatedly replaced by respectively C,G,T on each next position in the oligonucleotide. Below example is for a second order background model.

        #transition matrix
        Pr(A|AA)     Pr(C|AA)     Pr(G|AA)     Pr(T|AA)
        Pr(A|AC)     Pr(C|AC)     Pr(G|AC)     Pr(T|AC)
        Pr(A|AG)     Pr(C|AG)     Pr(G|AG)     Pr(T|AG)
        Pr(A|AT)     Pr(C|AT)     Pr(G|AT)     Pr(T|AT)
        Pr(A|CA)     Pr(C|CA)     Pr(G|CA)     Pr(T|CA)
        Pr(A|CC)     Pr(C|CC)     Pr(G|CC)     Pr(T|CC)
        Pr(A|CG)     Pr(C|CG)     Pr(G|CG)     Pr(T|CG)
        Pr(A|CT)     Pr(C|CT)     Pr(G|CT)     Pr(T|CT)
        Pr(A|GA)     Pr(C|GA)     Pr(G|GA)     Pr(T|GA)
        Pr(A|GC)     Pr(C|GC)     Pr(G|GC)     Pr(T|GC)
        Pr(A|GG)     Pr(C|GG)     Pr(G|GG)     Pr(T|GG)
        Pr(A|GT)     Pr(C|GT)     Pr(G|GT)     Pr(T|GT)
        Pr(A|TA)     Pr(C|TA)     Pr(G|TA)     Pr(T|TA)
        Pr(A|TC)     Pr(C|TC)     Pr(G|TC)     Pr(T|TC)
        Pr(A|TG)     Pr(C|TG)     Pr(G|TG)     Pr(T|TG)
        Pr(A|TT)     Pr(C|TT)     Pr(G|TT)     Pr(T|TT)


Example
#INCLUSive Background Model v1.0
#
#Order = 1
#Organism = Human
#Sequences =
#

#snf
0.2570.25340.24650.2432

#oligo frequency
0.257
0.2534
0.2465
0.2432

#transition matrix
0.3121    0.1944    0.2751    0.2184
0.2751    0.3014    0.1547    0.2688
0.24      0.2718    0.2943    0.1939
0.197     0.2469    0.2637    0.2924



See also: output



Other formats

MapFormat


The MapFormat can be used to output (and read back) entries in Map objects as a list of "key-value" pairs (where the key is the name of the motif/module/sequence depending on the type of map).


Arguments
NameDescription
Entry separator This parameter specifies which character to use to separate the key-value entries from each other in the output. The default is to output one entry on each line, but other means of separation is also possible. Valid values for this parameter are "Newline", "Space", "Tab", "Comma", "Semicolon" and "Colon". Note that the separator chosen here must be different from the "Key-value separator" selected below.
Key-value separator This parameter specifies which character to use to separate the key from the value for each entry. The default separation character is the equals sign (=), but other options are also available. Valid values for this parameter are "Newline", "Space", "Tab", "Comma", "Semicolon" and "Colon". Note that the separator chosen here must be different from the "Entry separator" selected above.
Include entries A collection which specifies which entries to include in the output. If no collection is specified (or an incompatible collection is chosen) all the entries will be output.
Include default If this option is selected, an entry for the default value will be included in the output. This will usually have the key "_DEFAULT_" (or no key at all).

See also: MapExpression, output, Numeric Maps


MapExpression


The MapExpression format can be used to read and write data for Map objects where the format to use is explicitly defined by the user in the form of a (regular) expression. The format outputs one entry on each line.

When outputting a Map in MapExpression format, the expression parameter should be a string which contains two special field codes: {KEY} and {VALUE} (the braces must be included and the letters must be in uppercase). The KEY field will be replaced by the name (identifier) of the data object in the map (motif, module or sequence) and the VALUE field will be replaced by the corresponding value for this data object. For example, the expression "{KEY}={VALUE}" will output the name of the data object and the value separated by an equals-sign, whereas the expression "ENTRY\t{VALUE}\t{KEY}" will output three TAB-separated columns on each row where the first column always has the text "ENTRY", the second column is the value and the last column is the name of the data object.

When importing a file in MapExpression format, the expression should be a regular expression string (formatted according to JAVA regex rules) containing at least two "capturing groups" enclosed in parenthesis. The two capturing groups should match the data name (key) and value respectively. The integer parameters "Key group" and "Value group" are used to tell MotifLab which of the groups are associated with each of these fields. For example, if the entries in the file correspond to the (output) expression "{KEY}={VALUE}", then the input expression could be "(\S+?)=(\S+)" with the value of "Key group" set to 1 and "Value group" set to 2. If the file is in the format "ENTRY\t{VALUE}\t{KEY}", then the input expression "ENTRY\t(\S+)\t(\S+)" can be used with "Key group" set to 2 and "Value group" set to 1 (since the key now occurs after the value in each line). It is possible to use more than two capturing groups, and the "Key group" and "Value group" parameters must then be adjusted accordingly.

Note that double quotes should preferably be avoided in the expression string since this can lead to parsing problems in the current version of MotifLab.


Arguments
NameDescription
Expression A string which defines the format to use for output or input. When outputting data in MapExpression format, this expression string should contain the two special field codes: {KEY} and {VALUE}, and these will be replaced by key-value data from the map. When reading input in MapExpression format, the expression string should be a regular expression containing at least two "capturing groups" that can capture the key and value information respectively from each line in the input. The parameters "Key group" and "Value group" below specify which capturing groups should be used to capture these two properties.
Key group An integer number that specifies which capturing group that captures the "key" from the input. This parameter is only applicable when reading input in the MapExpression format.
Value group An integer number that specifies which capturing group that captures the "value" from the input. This parameter is only applicable when reading input in the MapExpression format.
Include entries A collection which specifies which entries to include in the output. If no collection is specified (or an incompatible collection is chosen) all the entries will be output.
Include default If this option is selected, an entry for the default value will be included in the output. This will usually have the key "_DEFAULT_" (or no key at all).

See also: MapFormat, output, Numeric Maps


ExcelMap


The ExcelMap data format can be used to output (and read back) entries in Map objects to and from Excel files where one column contains the keys (the names of the motifs/modules/sequences depending on the type of map) and another column contains the corresponding values. When importing data from an Excel file, only entries in the key column that correspond to known data objects of the relevant type will be processed, which means that lines containing headers and other information will be skipped. The ExcelMap data format was introduced in MotifLab version 2.0.


Arguments
NameDescription
Key column This parameter specifies the column that contains the keys (names of motifs, modules or sequences). The column is specified as an integer number starting at 1 for the first (leftmost) column in the Excel file (first sheet).
Value column This parameter specifies the column that contains the corresponding map values for the motifs/modules/sequences. The column is specified as an integer number starting at 1 for the first (leftmost) column in the Excel file (first sheet).
Include entries A collection which specifies which entries to include in the output. If no collection is specified (or an incompatible collection is chosen) all the entries will be output.
Include default If this option is selected, an entry for the default value will be included in the output. This will usually have the key "_DEFAULT_" (or no key at all).

See also: MapFormat, MapExpression, ExcelProfile, output, Numeric Maps


ExpressionProfile


The ExpressionProfile format can be used to output Expression Profile data to plain text files and also import expression data from such files. Data for each sequence is output on a separate line with the sequence name at the beginning of the line followed by expression values for different conditions. The character which separates the sequence name from the expression values can be specified as a parameter, as can the character which separates the different expression values from each other (this would normally be the same as the character separating the sequence name from the expression values but it does not have to be).


Arguments
NameDescription
Sequence name delimiter This parameter specifies which character to use to separate the sequence names (first column) from the expression data values (the rest of the columns). Valid values for this parameter are "Space", "Tab", "Comma", "Semicolon", "Equals" and "Colon".
Condition delimiter This parameter specifies which character to use to separate the expression data columns from each other (the different conditions). Valid values for this parameter are "Space", "Tab", "Comma", "Semicolon" and "Colon".
Header Specifies whether a descriptive header should be included as the first line in the output. The parameter value "None" will not output any header. The value "Column names" will output a headder containing the name of each column (separated by the same characters as the data on the following lines). The value "#Column names" will output the same header as the previous setting, except that the line will be preceeding by a # sign (which will usually be interpreted as a comment line).

See also: ExcelProfile, output, Expression Profile


ExcelProfile


The ExcelProfile format can be used to output Expression Profile data to Excel files and also import expression data from such files. When data are output to files, each sequence will be output on a separate line with the sequence name in the first column and data for all the different conditions in subsequent columns. When data is imported from files, it is possible to specify which column that contains the sequence names and also which columns that contain the expression data to be included in the profile. This data format was introduced in MotifLab v2.0.


Arguments
NameDescription
Key column This input parameter specifies the column that contains the sequence names. The column is specified as an integer number starting at 1 for the first (leftmost) column in the Excel file (first sheet).
Value columns This optional input parameter specifies which columns that contain the expression data that should be included in the expression profile. This can be specified as a comma-separated list of column indices (starting at 1 for the leftmost column in the Excel file). It is also possible to specify ranges of columns using a hyphen. For example, if this parameter is set to "2,3,5-7,9" the profile will import data from the columns 2,3,5,6,7 and 9 (note that column 6 is in the range 5-7). If this parameter is left blank, all columns with valid numeric values to the right of the key column (containing the sequence names) will be included.
Include entries A sequence collection which specifies which sequences to include in the output. If no collection is specified, all sequences will be output.
Header If this parameter is selected when outputting data, a header containing the names of the condition columns will be output as the first row in the Excel file. If selected when importing data, the values found in the first row of the Excel file will be used as condition headers.

See also: output, Expression Profile


HTML


The "HTML" format can be used to output results from an Analysis object in a format suitable for viewing by humans. The format can output nicely formatted documents with headlines and descriptive text as well as tables and graphical images. The actual format of the output will depend on the specific analysis type, but will often include tables listing results obtained for each motif, module or sequence.


Arguments
NameDescription
analysis-specific Each type of analysis can have its own output parameters for the HTML format, but common parameters include which entries to include in the output (often specified as a Collection) and how to sort the output.
Logos Analyses related to motifs or modules usually allow you to include a graphical representation of each motif or module in the output. This is called a "logo", and you have a few options regarding how this will be handled.
  • None : Do not include any representation of the motif/module in the output
  • Text : For motifs, this will be a textual (non-graphical) representation of the consensus motif (e.g. "CAsyTG"). For modules it will be a list of transcription factors that are included in the module, with perhaps some other constraints.
  • Shared images : Each motif/module logo will be saved to a separate image file named after the motif/module (e.g. "MA0207"). This allows multiple HTML files to share the same motif/module logo files if you have performed and ouput several analyses based on the same motifs/modules. (Note, however, that this will cause trouble if you output multiple analyses that use different motifs/modules but these happen to have the same names.)
  • New images : Each motif/module logo will be saved to a separate image file named after the HTML-file followed by a number. This ensures that the image files are always correct, even if the analyses were based on different motifs/modules that happened to have the same names.
  • Embedded images : This option was introduced in MotifLab v2 and allows you to embed the logo images in the HTML file itself rather than saving each logo to a separate image file. Note, however, that if you choose this option, the logo images will not be viewable from inside of MotifLab (they will just look like broken image links), but it will still work if you save the output to a file and open it in a different web browser.

See also: output, Analysis


Excel


The "Excel" format can be used to output results from an Analysis to an Excel file. The actual format of the output will depend on the specific analysis type, but will often include tables listing results obtained for each motif, module or sequence. This data format was introduced in MotifLab v2.0.


Arguments
NameDescription
analysis-specific Each type of analysis can have its own output parameters for the Excel format, but common parameters include which entries to include in the output (often specified as a Collection) and how to sort the output.

See also: output, Analysis


RawData


The "RawData" format can be used to output results from an Analysis object in a "raw" text format that is suitable for parsing by another program (or for exporting the file to e.g. Excel). The actual format of the output will depend on the specific analysis type, but usually the output begins with one or more "header" lines (starting with #) that describe the settings used for running the analysis and the fields that are included in the output. This is usually followed by a table of data (with TAB-separated columns).


Arguments
NameDescription
analysis-specific Each type of analysis can have its own output parameters for the RawData format, but common parameters include which entries to include in the output (often specified as a Collection) and how to sort the output.

See also: output, Analysis


Template


MotifLab provides several data formats to allow users to output their data and analysis results in many different ways. Nevertheless, there may be times when the functionality offered by these formats is not enough, for example if a user has run several analyses and created multiple data objects and wants to combine information from all of these in a single compact document that follows a predefined layout.
The Template format (and its companion TemplateHTML) can be used in such cases to achieve greater control over the presentation of the output. The data formats requires a "template" document which must be provided in the form of a Text Variable. This template can contain regular text which can be interspersed with references to named data objects on the form: {dataobject}. When the template Text Variable is output in Template-format, the references to data objects in the text will be replaced with the actual contents of these data objects. No error message or warning will be given if the data object named in the reference does not exist or if there is some other mistake in the reference. In such cases, MotifLab will simply leave the original reference as is in the output. Note that only "simple" data objects such as Numeric Variables, Text Variables, Collections and OutputData objects can be referenced directly in the template. However, other types of data (such as feature data, partitions or maps) can be included by first outputting the original data object to an intermediate OutputData object in a selected data format. This intermediate object can then be referenced in the template.

The contents of a referenced data object will usually be included directly in a default format, but some control over the presentation is provided with additional options that can be specified after the name of the data object in the reference following a colon: {dataobject:options}.
Some data types can even have multiple options like so: {dataobject:option1:option2:etc...}

Available format-options for different data types:
Data typeOptionDescription
Numeric Variable PrecisionThe number of decimals to include for real values in the output can be specified in the option.
For example, to output the variable X with 2 decimals use the reference code: {X:2}.
PercentageIf the Numeric Variable holds a value between 0 and 1.0 which should be output as a percentage number, simply place a percentage sign in the option. The value of the variable will then automatically be multiplied by 100 and suffixed with a %-sign in the output. This option can be combined with the precision option by writing the %-sign after the number of decimals. If you want a space between the value and the %-sign in the output you can place the space-code "\s" before the %-sign (or if you combine precision number with the %-option you can just place a normal space between them).

Examples: The following shows different output for the variable X=0.2394278.
The reference code {X:%} will output 23.94278%
The reference code {X:\s%} will output 23.94278 %
The reference code {X:0%} will output 23%
The reference code {X:2%} will output 23.94%
The reference code {X:3 %} will output 23.942 %
Collection SeparatorCollections are normally output as sorted lists with entries separated by commas. However, it is also possible to specify a different separator as an option. E.g. to output the collection JASPAR with entries separated by semicolons instead of commas, use the reference code {JASPAR:;}. A space-separator can be specified as "\s", TAB-separator as "\t" and linebreaks as "\n" for plain text or "<br>" for HTML. To use a colon as a separator, simply type "colon", e.g. {JASPAR:colon}.
SizeTo output the size of a collection rather than listing the entries, use the "size" option, or equivalently enclose the name of the collection in vertical bars. E.g. {JASPAR:size} or {|JASPAR|}.
Text Variable

   and

Output Data
SeparatorThe contents of Text Variables and Output Data objects are usually included verbatim in the final document one line at a time. However, it is possible to use a different separator for the lines rather than the usual linebreak separator (which is "\n" for plain text and "<br>" for HTML). This separator is then specified as the first option. Spaces, TABs and colons can be used as separators as described for the Collections type above.
SortingIt is possible to sort the lines from the Text Variable or Output Data according to a natural order by specifying a second option (after the first "separator" option). There are many ways to do this. If the second option includes the text "sort", "asc" or "A" the lines will be sorted in ascending order (e.g. "sort", "sorted", "sort ascending", "ascend","sortA" or simply "A"). However, if the option contains the text "des" or "D" they will be sorted in descending order (e.g. "sort desc", "sort descending", "descend", "desc", "sortD" or simply "D").

The following examples show how the lines from the Text Variable X can be sorted. Note that since sorting must be specified as a second option, the "separator" must be included as the first option (but by just leaving it blank the default separator will be used).
The reference code {X::sort} will output X with lines in ascending order separated by default linebreaks.
The reference code {X::ascending} will output X with lines in ascending order separated by default linebreaks.
The reference code {X::D} will output X with lines in descending order separated by default linebreaks.
The reference code {X:\t:asc} will output X with lines in ascending order separated by TABS.
Remove duplicates The second option can also be used to specify that duplicate lines in the Text Variable or Output Data object should be removed by including the text "uniq" or "U" anywhere in the option. Note that this can be combined with the sorting option, as shown in the last three examples below:

The reference code {X::uniq} will output all unique lines from X separated by default linebreaks.
The reference code {X::sorted unique} will output all unique lines from X sorted in ascending order.
The reference code {X::unique ascending} will output all unique lines from X sorted in ascending order.
The reference code {X:,:DU} will output all unique lines from X in descending order separated with commas.


Example:
In the following scenario, a user has created a protocol script to find significant transcription factor motifs in promoters for sets of sequences that are either up- or downregulated at three different timepoints (1h, 2h or 3h). The sequence collections are named Up1, Up2, Up3, Down1, Down2 and Down3, and the collections of significant motifs are called Motifs_Up1, Motifs_Up2, Motifs_Up3, Motifs_Down1, Motifs_Down2 and Motifs_Down3. What the user wants now is to create a simple report that contains information about how many sequences there were in each such collection and list the names of the significant TFs for each collection. The following protocol first creates six OutputData objects containing names of significant TFs and then creates the final report based on a predefined template.
Motifs_Up1_out = output Motifs_Up1 in Motif_Properties format {Format="Clean Short name"}
Motifs_Up2_out = output Motifs_Up2 in Motif_Properties format {Format="Clean Short name"}
Motifs_Up3_out = output Motifs_Up3 in Motif_Properties format {Format="Clean Short name"}
Motifs_Down1_out = output Motifs_Down1 in Motif_Properties format {Format="Clean Short name"}
Motifs_Down2_out = output Motifs_Down2 in Motif_Properties format {Format="Clean Short name"}
Motifs_Down3_out = output Motifs_Down3 in Motif_Properties format {Format="Clean Short name"}

TemplateText = new Text Variable(File:"Template_text.txt", format=Plain)
Output1= output TemplateText in Template format

The file "Template_text.txt" which is used in the protocol above to provide the template text for the final report is shown below. All references to data objects in the template are marked in red color. First the template produces a 2x3-table with the sizes of each of the sequence collections. Then it writes out 6 lines listing the significant transcription factors for each such collection. It would be possible to reference the motif collections directly in the template, e.g. {Motifs_Up1}. However, this would then only list the IDs of the motifs and not the TF-names, so instead the protocol above uses the Motif_Properties data format to output the "clean short name" of each motif in each collection to an intermediate OutputData object that is referenced instead (Motifs_Up1_out). These OutputData objects contains one TF-name on each line and there might be duplicate names if there are several motif models for the same TF. Hence, the template specifies that the names in the OutputData objects should be sorted alphabetically and duplicate names should be removed (using the "sorted unique" option). Also, rather than using a linebreak to separate the TF-names, a comma should be used instead.
Number of genes up- and down-regulated at different time points:

Time    1h       2h       3h
--------------------------------
UP      {Up1:size}    {Up2:size}   {Up3:size}
DOWN    {Down1:size}  {Down2:size} {Down3:size}
================================

Significant transcription factors in promoters of these genes:

Up 1h: {Motifs_Up1_out:,:sorted unique}
Down 1h: {Motifs_Down1_out:,:sorted unique}
Up 2h: {Motifs_Up2_out:,:sorted unique}
Down 2h: {Motifs_Down2_out:,:sorted unique}
Up 3h: {Motifs_Up3_out:,:sorted unique}
Down 3h: {Motifs_Down3_out:,:sorted unique}

The result could look something like this:
Number of genes up- and down-regulated at different time points:

Time      1h     2h     3h
--------------------------------
UP        23     42     31
DOWN      17     35     26
================================

Significant transcription factors in promoters of these genes:

Up 1h: EGR1,FOS1
Down 1h: 
Up 2h: FOXD1,GATA2,HOXA5,IRX5,JUND
Down 2h: E2F5,KLF15,NR2C1
Up 3h: ATF5,NFX1,NKX3-1,ZHX2
Down 3h: EVI1,HEYL,HOXC9,POU2F1



See also: TemplateHTML, output, Text Variable, Output Data


TemplateHTML


MotifLab provides several data formats to allow users to output their data and analysis results in many different ways. Nevertheless, there may be times when the functionality offered by these formats is not enough, for example if a user has run several analyses and created multiple data objects and wants to combine information from all of these in a single compact document with follows a predefined layout.
The TemplateHTML format (and its companion Template) can be used in such cases to achieve greater control over the presentation of the output. The data format requires a "template" document which must be provided in the form of a Text Variable. This template can contain regular text and HTML-markup which can be interspersed with references to named data objects on the form: {dataobject}. When the template Text Variable is output in TemplateHTML-format, the references to data objects in the text will be replaced with the actual contents of these data objects. No error message or warning will be given if the data object named in the reference does not exist or if there is some other mistake in the reference. In such cases, MotifLab will simply leave the original reference as is in the output. Note that only "simple" data objects such as Numeric Variables, Text Variables, Collections and OutputData objects can be referenced in the template. However, other types of data objects (such as feature data, partitions or maps) can be included by first outputting these to intermediate OutputData objects which can then be referenced.

The contents of a referenced data object will usually be included directly in a default format, but some control over the presentation is provided with additional options which are described in the documentation for the Template format.

Example:
In the following scenario, a user has created a protocol script to find significant transcription factor motifs in promoters for sets of sequences that are either up- or downregulated at three different timepoints (1h, 2h or 3h). The sequence collections are named Up1, Up2, Up3, Down1, Down2 and Down3, and the collections of significant motifs are called Motifs_Up1, Motifs_Up2, Motifs_Up3, Motifs_Down1, Motifs_Down2 and Motifs_Down3. What the user wants now is to create a simple report that contains information about how many sequences there were in each such collection and list the names of the significant TFs for each collection. The following protocol first creates six OutputData objects containing names of significant TFs and then creates the final report based on a predefined template.
Motifs_Up1_out = output Motifs_Up1 in Motif_Properties format {Format="Clean Short name"}
Motifs_Up2_out = output Motifs_Up2 in Motif_Properties format {Format="Clean Short name"}
Motifs_Up3_out = output Motifs_Up3 in Motif_Properties format {Format="Clean Short name"}
Motifs_Down1_out = output Motifs_Down1 in Motif_Properties format {Format="Clean Short name"}
Motifs_Down2_out = output Motifs_Down2 in Motif_Properties format {Format="Clean Short name"}
Motifs_Down3_out = output Motifs_Down3 in Motif_Properties format {Format="Clean Short name"}

TemplateText = new Text Variable(File:"Template_text.html", format=Plain)
Output1= output TemplateText in TemplateHTML format

The file "Template_text.html" which is used in the protocol above to provide the template text for the final report is shown below. All references to data objects in the template are marked in red color. First the template produces a 2x3-table with the sizes of each of the sequence collections. Then it writes out a second table listing the significant transcription factors for each such collection. It would be possible to reference the motif collections directly in the template, e.g. {Motifs_Up1}. However, this would then only list the IDs of the motifs and not the TF-names, so instead the protocol above uses the Motif_Properties data format to output the "clean short name" of each motif in each collection to an intermediate OutputData object that is referenced instead (Motifs_Up1_out). These OutputData objects contains one TF-name on each line and there might be duplicate names if there are several motif models for the same TF. Hence, the template specifies that the names in the OutputData objects should be sorted alphabetically and duplicate names should be removed (using the "AU" option).
<h2>Number of genes up- and down-regulated at different time points:</h2>

<table>
    <tr><th>Time</th><th>1h</th><th>2h</th><th>3h</th></tr>
    <tr><td>Up</td><td>{Up1:size}</td><td>{Up2:size}</td><td>{Up3:size}</td></tr>
    <tr><td>Down</td><td>{Down1:size}</td><td>{Down2:size}</td><td>{Down3:size}</td></tr>
</table>

<br>

<h2>Significant transcription factors in promoters of these genes:</h2>

<table>
<tr>
    <th style="background-color:#E0E0E0;">1h</th>
    <th style="background-color:#C8C8C8;">2h</th>
    <th style="background-color:#B0B0B0;">3h</th>
</tr>
<tr>
    <td valign=top style="background-color:#FFD0D0;">{Motifs_Up1_out::AU}</td>
    <td valign=top style="background-color:#FFC0C0;">{Motifs_Up2_out::AU}</td>
    <td valign=top style="background-color:#FFC0B0;">{Motifs_Up3_out::AU}</td>
</tr>
<tr>
    <td valign=top style="background-color:#D0FFD0;">{Motifs_Down1_out::AU}</td>
    <td valign=top style="background-color:#C0FFC0;">{Motifs_Down2_out::AU}</td>
    <td valign=top style="background-color:#B0FFB0;">{Motifs_Down3_out::AU}</td>
</tr>
</table>


The result could look something like this:

Number of genes up- and down-regulated at different time points:

Time1h2h3h
Up 23 42 31
Down173526

Significant transcription factors in promoters of these genes:

1h 2h 3h
EGR1
FOS1
FOXD1
GATA2
HOXA5
IRX5
JUND
ATF5
NFX1
NKX3-1
ZHX2
E2F5
KLF15
NR2C1
EVI1
HEYL
HOXC9
POU2F1



See also: Template, output, Text Variable, Output Data


Properties


The "Properties" data format relies on a template text supplied via a Text Variable to format the output of motifs, modules or sequences. The template can contain a mix of literal text and references to named motif/module/sequence properties on the form "{propertyName}". These references will be replaced by the actual values of the properties when a data object is output.

The following example shows a small template to output three motif properties:
Motif ID = {ID}
Name = {Short name}
Length = {size}


Repeat blocks
   A repeat block is a convenient, short-hand way of outputting multiple properties in a similar fashion. A repeat block starts off with a header line consisting of a percentage sign followed by a comma-separated list of properties. This header is then followed by any number of regular template lines. The repeat block is ended when encountering a line containing a double percentage sign. When a data object is output, all the lines between the single and double percentage signs will be repeated once for each property in the list. In additional to regular named property references, the lines within a repeat block can contain the special references "{key}" and "{value}" which refers to the name and value of the property currently being processed. The list of properties to repeat over can contain the wildcard symbol "*", which will then add all known properties to the list, or the subset wildcards "*standard" (all standard properties) and "*user" (all non-standard user-defined properties). If the name of a property in the list is preceeded by a minus sign, it will be removed from the current list of properties. Hence, the list "*,-ID" will include all properties except "ID".

The motif template below will output the properties "Short name", "Consensus" and "IC-content" followed by all user-defined properties except the two named "Pazar" and "Medline". Each line will consist of the ID of the current motif followed by a colon, and then the name of a property from the list and its respective value separated by an equals sign.
%Short name, Consensus, IC-content, *user, -Pazar, -Medline
{ID}: {key} = {value}
%%

The list of properties in the repeat block header can optionally be followed by a colon and then a series of settings specifications in the form of keywords that further control the formatting of the repeat block:
  • skip and blank: These settings will override the "If missing" parameter of the data format for this repeat block only.
    A header on the form "%property:skip" thus essentially represents a conditional block that will only be output if the named property is defined for the data object.
  • [default]: A value enclosed in brackets will be used as a default when a data object does not have a defined value for the property.
    If specified, this setting overrides both "skip" and "blank".
  • "separator": A string enclosed in double quotes will be used as the separator when outputting properties with multiple values (lists).
    Use "\t" to represent TAB and "\n" for newline. This setting will default to comma unless specified.
  • inline: This setting is really only useful if the repeat block consists of a single line. When in use, all the properties will be output on the same line immediately after each other. Also, unless explicitly specified with the "break before/after" settings, there will be no linebreaks occurring before and after the list of properties.
  • break before and break after: These keywords can be used in combination with the "inline" setting to force linebreaks to occur before and/or after the inline repeat block.
  • 'separator': A string enclosed in single quotes will be used as the separator when outputting a list of properties with an inline repeat block.
    Use "\t" to represent TAB. If unspecified, no separator will be output between the properties.
  • expand list: This keyword (which is incompatible with "inline") can apply when a property has multiple values in the form of an explicit list or a comma-separated string. In this case, instead of replacing the {value} reference with the whole list as one string (with entries separated by commas unless otherwise specified), the whole repeat block will itself be repeated for every value from the list, and each time the {value} reference will be replaced with this single value.

Matrix block
   A matrix block is special kind of repeat block used to format the variable-length binding matrix of a motif. The special "{key} and {value}" references are not defined for this kind of repeat block. Instead the matrix block has a a few other references, including "{A}, {C}, {G} and {T}" which refers to the matrix values for these bases. A binding matrix can be output in either vertical (N×4) or horizontal (4×N) orientation, and the repeat block will behave differently in these two cases.

In the case of vertical orientation, the repeat block will be repeated N times (where N is the length of the motif), and with each repetition the values of {A}, {C}, {G} and {T} will refer to the next position in the matrix. The current position (row counter) can be accessed with the special references "{row}" or "{rowXX}", where the latter will always return the position in double digits. (If you want a row counter starting at 0 rather than 1, use the references "{row-1}" or "{rowXX-1}" instead). Another special reference "{x}" can be used to access the consensus base letter for the position. This base letter will be in uppercase for regular DNA bases and in lowercase for degenerate bases. The reference "{X}" will always return the base letter in uppercase.
%matrix: vertical
{row}  {A},{C},{G},{T},{x}
%%

In the case of horizontal orientation, the repeat block itself will not be repeated more than once. Instead, the references {A}, {C}, {G}, {T} and {x} will contain lists of values rather than single values. The values in these lists will be separated by a comma unless a different separator is specified within a pair of double quotes in the block header. The special reference "{columns}" (and also "{columnsXX}, {columns-1} and {columnsXX-1}") contains column position counters in similarly formatted lists.
%matrix: horizontal ","
{columns}
{A}
{C}
{G}
{T}
%%

The settings string in the header of the matrix block can contain the keywords "count" or "frequency" to force the matrix to be output in a count-matrix format (only integers) or normalized frequencies format (values between 0 and 1) instead of the default formats used by each motif internally.


Headers, footers and separators
   The template can optionally contain the definition of a header that will be output at the beginning of the document, a footer that will be output at the end, and a separator that will be output between each entry when multiple data objects are output. If included, these must be defined at the very top of the template and introduced by the keywords "HEADER:", "FOOTER:" and "SEPARATOR:" respectively, as shown in the example below (note that the keywords have to be in uppercase!). Each definition must be contained on a single line, but you can force linebreaks by including the newline character "\n". The header, footer and separator can not contain any property references, but they can contain the special reference "{size}" which is the size of the collection being output and "{counter}" which is a number that starts at 1 and is incremented for each entry output ("{counter-1}" is similar but starts the counting at 0).
HEADER:This is the first line of the header \n and this is the second line...
FOOTER:this is the footer text...
SEPARATOR:this line of text will separate the entries


Since templates can contain any text, the "Properties" format can be used to mimic nearly all other data formats for outputting motifs, modules or sequences, as demonstrated by the following example templates:

Example #1: BED format
   Since genomic sequence coordinates in BED files start at 0 rather than 1, a "[0]" suffix has been added to the "genomic start" property in the second column. The same suffix has not been added to the "genomic end" property in third column, however, since this coordinate is exclusive according to the BED-format definition, and exclusive 0-indexed end-coordinates are the same as inclusive 1-indexed end-coordinates. The "score" value in column five is just set to the constant number "1000".
{chromosome string}   {genomic start[0]}   {genomic end}   {name}   1000   {orientation sign}


Example #2: GFF format
   The ninth and final column of the GFF sequence format contains a semi-colon separated list of additional attributes defined as key="value" pairs. The template below outputs the sequence name as the first such attribute and if the sequence has any other user-defined attributes these will be output directly behind on the same line using a repeat block with the "inline" setting.
{chr}   ML   Seq   {genomic start}   {genomic end}   1000   {orientation sign}   .   name="{name}";
%*user: inline, skip, break after
{key}="{value}";
%%


Example #3: JASPAR format
   The motif format used by the JASPAR database is very simple, consisting of just a FASTA-like header followed by four lines that define the matrix values for the four DNA bases. This template demonstrates how to use a repeat block to output the "matrix" property of the motif in a horizontal orientation. The TAB-sign "\t" is used to separate the columns in the matrix rather than the default separator (comma). Note that the template also includes an explicit entry SEPARATOR which is inserted between every motif in the output. In this case the separator is empty and will result in an empty line being output between each motif.
SEPARATOR:
>{ID}
%matrix:horizontal count "\t"
A [{A}]
C [{C}]
G [{G}]
T [{T}]
%%


Example #4: TRANSFAC format
   The header of the TRANSFAC motif format is split across three lines with the use of the newline character "\n". The repeat block used to format the vertically oriented matrix includes both the row number in double digits "{rowXX}" and the consensus letter in upper case "{X}".
HEADER:VV  TRANSFAC MATRIX TABLE\nXX\n//
AC  {ID}
XX
ID  {name}
XX
NA  {Clean short name}
XX
P0   A   C   G   T
%matrix: vertical
{rowXX}   {A}   {C}   {G}   {T}   {X}
%%
XX
//


Example #5: XMS format
   XMS is an XML-based motif format where normalized frequency matrices are output in a vertical orientation. All the <motif> elements are enclosed in an outer <motifset> tag defined by HEADER and FOOTER.
HEADER:<motifset>
FOOTER:</motifset>
 <motif>
   <name>{Short name}</name>
      <weightmatrix alphabet="DNA" columns="{size}">
%matrix: vertical frequency
         <column pos="{row-1}">
            <weight symbol="thymine">{T}</weight>
            <weight symbol="guanine">{G}</weight>
            <weight symbol="cytosine">{C}</weight>
            <weight symbol="adenine">{A}</weight>
         </column>
%%
      </weightmatrix>
      <prop>
         <key>Motif_ID</key>
         <value>{ID}</value>
      </prop>
 </motif>



Arguments
NameDescription
Template The Text Variable containing the output template for formatting a motif, module or sequence.
If missing This parameter controls how to behave when a motif/module/sequence does not have a defined value for a particular property referenced in the template. The available options are "Leave blank", which will just replace the property reference itself with an empty string, or "Skip line" which will omit the whole line (or even whole repeat block) containing the property reference from the output.

For example, consider a template for formatting motifs containing the following three lines:
   Motif ID = {ID}
   Class = {Transfac class}
   Name = {Short name}

Now assume that the JASPAR motif "MA0004 - Arnt" does not have a defined value for the "Transfac class" property.
If the "If missing" option was set to "Leave blank", the output for this motif would be:
   Motif ID = MA0004
   Class =
   Name = Arnt

However, if the "If missing" option was set to "Skip line", the output would instead be:
   Motif ID = MA0004
   Name = Arnt

Sort by If this optional parameter is specified, the entries in the input collection will be sorted according to their ascending values in this map. If unspecified, the entries will be sorted in natural order.

See also: output, Motif_Properties, Module_Properties, Sequence_Properties, Template, Text Variable


Location


The "Location" format is used to describe the location of sequences. The format lists one sequence on each line in the output with multiple TAB-separated columns containing different information. Several varieties of the format exists with different number of fields, either 10, 8 or 4. In addition, there is a 6-field format that can only be used for input (read by MotifLab). If the predefined formats are not enough, it is also possible to define new custom formats.

10-field format
  1. Sequence identifier
  2. Organism (taxonomy ID)
  3. Genome build
  4. Chromosome
  5. Start of sequence segment (genomic coordinate)
  6. End of sequence segment (genomic coordinate)
  7. Gene name (this could be the same as the sequence ID)
  8. Transcription start site for the gene (genomic coordinate). This is optional and can be set to NULL
  9. Transcription end site for the gene (genomic coordinate). This is optional and can be set to NULL
  10. The strand orientation of the sequence/gene. (DIRECT, +1, +) or (REVERSE, -1, -)

Examples
ENSG00000111249  9606  hg18  12  109954212  109956411  CUX2    109956212  110272739  Direct
ENSG00000187664  9606  hg18  19   19244979   19247178  HAPLN4   19245178   19226557  Reverse
ENSG00000196358  9606  hg18   9  134025155  134027354  NTNG2   134027155  134109742  -


8-field format

The 8-field format is a subset of the columns in the 10-field format with the organism identifier and gene name omitted.
The organism is then derived from the genome build and the gene name is set to the same as the sequence identifier.
  1. Sequence identifier
  2. Genome build
  3. Chromosome
  4. Start of sequence segment (genomic coordinate)
  5. End of sequence segment (genomic coordinate)
  6. Transcription start site for the gene (genomic coordinate). This is optional and can be set to NULL
  7. Transcription end site for the gene (genomic coordinate). This is optional and can be set to NULL
  8. The strand orientation of the sequence/gene. (DIRECT, +1, +) or (REVERSE, -1, -)

Examples
UNG      hg18    12    108017798    108019997    108019798    NULL       DIRECT BRCA2    hg18    13     31785617     31787816     31787617    NULL       + HAPLN4   hg18    19     19244979     19247178     19245178    19226557   Reverse


6-field format

This format specifies the locations of sequences relative known genes. Note that this format can only be used as input.
  1. Gene identifier (depending on type)
  2. Name of gene identifier type (e.g. "Ensembl Gene", "Entrez Gene" or "HGNC Symbol")
  3. Genome build
  4. Start of sequence segment relative to anchor point (see field #6)
  5. End of sequence segment relative to anchor point (see field #6)
  6. Anchor point. This could either be "TSS", "TES". MotifLab v2 also supports the anchor "full gene".

Examples
NTNG1             HGNC Symbol    hg18    -2000    200    TSS 56475             Entrez Gene    hg18    -2000    200    TSS ENSG00000111249   Ensembl Gene   hg18    -2000    200    TSS ENSG00000187664   Ensembl Gene   hg18    -2000    200    TSS ENSG00000196358   Ensembl Gene   hg18    -2000    200    TSS


4-field format
  1. Sequence identifier
  2. Chromosome
  3. Start of sequence segment (genomic coordinate)
  4. End of sequence segment (genomic coordinate)
There is also a "relative 4-field format" which is similar to the regular 4-field format with one exception. If a sequence is associated with the reverse strand, the start and end coordinates will be swapped so that the value in the 3rd column is larger than the value in the 4th column.


Custom format

When the "custom format" is used, the fields to output and how to separate them can be specified manually by describing a string containing special field codes. The following field codes are recognized (case-insensitive):
  • Sequence name (or just "name")
  • Gene name
  • Chromosome
  • Start
  • End
  • Relative start
  • Relative end
  • TSS
  • TES
  • Strand
  • Genome build (or just "build")
  • Organism (or "taxonomy")
  • Organism name
  • Organism latin name

Example: the custom format "Sequence name,chromosome,start,end" will be similar to the standard 4-field format except that commas are used instead of TABs to separate to fields (to insert TABs use the escape code: \t )


Arguments
NameDescription
Format The version of the format to use for output. Valid options are:
  • 10 field format
  • 8 field format
  • 4 field format
  • 4 field format (relative)
  • Custom format
These formats are described above
Custom Format If "Custom Format" is selected for the "Format" parameter, the format string must be specified with this parameter as described above for the custom format.
add CHR prefix If this option is selected, a "chr" prefix will be added to the chromosome number when outputting chromosomes.
Strand notation This parameter specifies what notation to use to output the strand orientation of sequences. Valid options are "Direct/Reverse", "+1/-1" or "+/-".

See also: output


Sequence_Properties


The Sequence_Properties format will output a table with one sequence on each row and with columns containing information about different sequence properties chosen by the user.

Example of properties output with the format string "name, gene name, organism name, chromosome, genomic start, genomic end" (with header)
#name               gene name    organism name    chromosome    genomic start   genomic end ENSG00000035403     VCL          Human            10            75425878        75428077 ENSG00000100345     MYH9         Human            22            35113759        35115958 ENSG00000107796     ACTA2        Human            10            90702310        90704509 ENSG00000130176     CNN1         Human            19            11508579        11510778 ENSMUSG00000017167  Cntnap1      Mouse            11            101168523       101170722



Arguments
NameDescription
Format This parameter specifies which sequence properties to include in the output as an ordered, comma-separated list of property names. Note that standard properties are case-insensitive, but user-defined properties are case-sensitive!

Standard sequence properties include:
  • name
  • gene name
  • chromosome
  • genomic start
  • genomic end
  • TSS[0]-relative start
  • TSS[0]-relative end
  • TES[0]-relative start
  • TES[0]-relative end
  • TSS[1]-relative start
  • TSS[1]-relative end
  • TES[1]-relative start
  • TES[1]-relative end
  • TSS
  • TES
  • length
  • organism ID
  • organism name
  • organism latin name
  • genome build
  • orientation
  • orientation string
  • orientation sign
The genomic coordinates returned by genomic start, genomic end, TSS and TES assumes that the chromosome starts at position 1, but it is possible to return zero-based coordinates by adding the suffix "[0]" directly behind these properties. E.g. the property "genomic start[0]" will return a number which is one less than the regular "genomic start". The "TSS/TES[n]-relative" coordinates returns the start or end of the sequence relative to the position of TSS or TES. If the number within the brackets is 0, the position of TSS/TES will be 0 with downstream bases having increasing positive coordinates and upstream bases having increasing negative coordinates. If the number in the brackets is [1], the position of TSS/TES is +1, the immediate downstream base is at +2 and the immediate upstream base is at -1 (hence, the counting skips 0 and goes directly from -1 to +1 at TSS/TES).
Separator This parameter specifies how to separate the sequence properties on each line in the output. The character chosen as the separator will replace the commas in the format string above. Valid options for the separator are "TAB" (default), "Comma", "Semicolon", "Colon" and "Vertical bar".
List-separator Some sequence properties may be represented by lists (e.g. GO-terms). The "List-separator" parameter specifies how to separate the entries in such lists. Valid options are "Comma" (default), "TAB", "Semicolon", "Colon" and "Vertical bar". Note that this separator should be different from the separator used to separate the sequence properties that are output.
Header If this option is selected, a header line starting with # will be included at the beginning of the output. The header line describes which sequence properties are included.

See also: output, Motif_Properties, Module_Properties, Properties


Graph


The Graph dataformat enables users to create their own graphical charts (bar charts, line charts, boxplots, pie charts etc.) based on numerical data stored in Text Variables or OutputData objects. The input data must be formatted in specific ways depending on the particular chart chosen, and the dataformat will use this data to produce a document in HTML format with a single embedded image (or two images if the chart legend is output as a separate image).
Examples showing how to dynamically assemble a data table and use this as the basis for creating box plots and histograms: #1 , #2.

Data format requirements
ChartData format
Line chartAll formats are accepted. If the input is in "lines" format, only the first two numeric values from each line will be used to define a data point (x,y) and multiple points must be specified on separate lines.
Pie chartAll formats are accepted. Only the first value is used from each series. The pie segments are scaled accordingly.
Bar chartAll formats are accepted but "lines" is required if bars are to include standard deviation whiskers (since these must be provided as a third value after X (category) and Y.
HistogramAll formats are accepted. This chart type ignores dimensionality of data points and will derive the histogram based on all values associated with each series.
Box plotThe input data should be in "lines" format with at least 5 values for each series that specify respectively the "minimum" value (bottom whisker), "first quartile" (bottom of box), "median", "third quartile" (top of box) and "max" value (top whisker). If at least 7 values are provided, the 6th value should be the "average" and the 7th should be the "standard deviation". Any additional values after these seven will be regarded as outlier values.
However, if the "percentiles" plot setting is specified, the statistics will instead be derived dynamamically based on all the values associated with each series.



Arguments
NameDescription
Graph type
  • Line chart
  • Bar chart
  • Pie chart
  • Box plot
  • Histogram
Note that "Line chart" can also be used to draw scatter plots.
Data format This parameter specifies how the data in the OutputData or TextVariable is formatted. Three different formats are recognized:
Columns:
The data should be arranged in a table with TAB-separated columns. The first column should contain the X-values and the subsequent columns the corresponding Y-values for different series. The first row should include the names of the series starting from column 2. The top-left cell is not used. Instead of numeric values, the first column could optionally contain category names. (These will actually be converted into integers internally (starting at 1.0) for purposes of setting the range of the X-axis.)
Rows:
This format is the transpose of the "Columns" format where rows play the role of columns and vice versa.
Lines:
Each line must be TAB-separable into at least two columns. The first column must contain the name of the series and the subsequent columns define a multi-dimensional data point [X,Y,Z,...]. This is the only format that supports more than two dimensions for data points. The X-values in the second column could optionally be category names instead of numeric values. It is possible to define multiple data points for a series by repeating the series name over several lines.
The interpretation of the dataset will depend on the chosen graph type (and possibly also selected plot settings).
For example, the "line chart" only uses values for the first two dimensions (X,Y) even if more values are provided. For the "histogram" graph type, the dimensionality of the data points have no meaning and the distribution will be based on all values provided for each series.
Plot settings A semi-colon separated list of key=value pairs that control various aspects of the plot. The most important settings to specify are the colors to use for drawing each series in the chart, since series that do not have explicitly assigned colors will always be drawn in black.

Colors and style can be defined with
    <seriesname> = <color> , <linestyle> , <pointstyle>       (both the linestyle and pointstyle can be omitted)

  • Colors can either be specified by name (e.g. "red"), with a six-digit hexadecimal code ("#FF23C8") or three comma separated values (red,green,blue) between 0 and 255
  • Recognized line styles are : solid, dashed, longdashed, dotted and none
  • Recognized point styles are : circle, filledcircle, box, filledbox, cross, plus, star, dot and none

  • Note that it is possible to draw one or more series as "scatter plots" by setting their linestyle to none and the pointstyle to any other style besides none in line charts.

    Color and styles for different series can alternatively be specified with display settings on the form:
    $setting("graph.<property>.<seriesname>")=value   (where <property> is either "color", "linestyle" or "pointstyle")

Additional plot settings include:
  • legend=none | top | bottom | left | right | separate : Specifies where to place an optional legend box relative to the graph itself. If the option "separate" is chosen, the legend will be drawn in a separate image, else it will be drawn in the same image as the graph.
  • legendBox=yes | no : Specifies whether or not to draw a bounding box (border) around the legend.
  • legendHorizontal=yes | no : Specifies whether to draw the legend box in a horizontal orientation (with series names behind each other on the same line) or vertical orientation (with series names beneath each other).
  • legendMargin=<value> : A size of a margin region between the graph and the legend box.
  • legendSpacing=<value> : The spacing between the series names when the legend box is drawn in a horizontal orientation
  • margin=<value> : A margin drawn around the entire graph image
  • legendText=<item1,item2,..,itemN> : If a comma-separated list of strings is provided with this setting, the legend will be based on these strings rather than the series names (remember to set the colors!).
Line graphs, bar graphs, box plots and histograms (those drawn on a two-dimensional axis system)
  • axis=cross | box : The default "box" option will enclose the graph in a box and draw the axes on the outside (usually with the Y-axis on the left and the X-axis below). If the axes span both negative and positive values, the "cross" option will draw an axis-cross centered at the origo.
  • box=yes | no : Specifies whether or not to draw a bounding box (border) around the whole axes system.
  • vgrid=solid | dashed | dotted | none : Specifies the line-style to use for vertical grid lines
  • hgrid=solid | dashed | dotted | none : Specifies the line-style to use for horizontal grid lines
  • verticalGridLines=x1,x2,..,xN : An explicit list of values that dictates where to place vertical gridlines along the X-axis. The list can alternatively be specified as three colon-separated values, where the first value is the start, the second is the spacing and the last is the end.
  • horizontalGridLines=y1,y2,..,yN : An explicit list of values that dictates where to place horizontal gridlines along the Y-axis (or start:spacing:end)
  • tickX=yes | no : Specifies whether or not to draw tick marks and labels on the X-axis
  • tickY=yes | no : Specifies whether or not to draw tick marks and labels on the Y-axis
  • percentageX=yes | no : Specifies that the values along the X-axis should be rendered as percentages (or not)
  • percentageY=yes | no : Specifies that the values along the Y-axis should be rendered as percentages (or not)
  • verticalXticks=yes | no : Specifies that the values along the X-axis should be drawn in a vertical orientation (or not)
  • verticalXticksUp=yes | no : Specifies that values drawn in vertical orientation along the X-axis should be drawn from the bottom up (so that you have to tilt your head to the left to read them) or top-down (so that you have to tilt your head to the right).
  • tickXLabels=x1,x2,..,xN : An explicit list of ticks/labels to draw along the X-axis instead of the regular tick marks. Each entry in the list should be on the form "x-value:label" where the x-value specifies the position along the X-axis where the label will be drawn and "label" is the text to use for the label.
  • tickYLabels=y1,y2,..,yN : An explicit list of ticks/labels to draw along the Y-axis instead of the regular tick marks. Each entry in the list should be on the form "y-value:label" where the y-value specifies the position along the y-axis where the label will be drawn and "label" is the text to use for the label.
  • extendRange=<X,Y> : Normally, the range of the axes will be set so that they exactly fit the dataset. This setting will extend the graph axes in one or more directions to provide more space around the graph itself. The value can either be a single number, two comma-separated numbers (X,Y) or four numbers (minX,maxX,minY,maxY) and they can be either absolute or relative (percentage).
    For example, if the original axes ranges for a graph are X=[0,100] Y=[10,25], the setting "extendRange=2,5,10,10" will extend the X-axis by 2 to the left and 5 to the right and the Y-axis will be extended by 10 in both directions resulting in the range X=[-2,105] Y=[0,35]. On the other hand, the setting "extendRange=0,10%" will only extend the Y-axis by 10% resulting in the axes X=[0,100] Y=[8.5,26.5].
  • minX=<value> : Explicitly sets the minimum value for the X-axis. This will override the extendRange setting.
  • maxX=<value> : Explicitly sets the maximum value for the X-axis. This will override the extendRange setting.
  • minY=<value> : Explicitly sets the minimum value for the Y-axis. This will override the extendRange setting.
  • maxY=<value> : Explicitly sets the maximum value for the Y-axis. This will override the extendRange setting.
  • xLabel=<text> : An optional label for the X-axis
  • yLabel=<text> : An optional label for the Y-axis
  • title=<text> : An optional title to display above the graph
  • xLabelMargin=<value> : A margin between the X-axis and the label for the X-axis
  • yLabelMargin=<value> : A margin between the Y-axis and the label for the Y-axis
  • margin=<value> : A margin between the title and the graph
Line charts:
  • point size=<value> : The size of the geometric shape drawn at each data point along the line (default=3)
  • shadow=<offset> : If this distance offset value is greater than 0, the lines will be drawn with drop-shadows at the specified distance
Bar charts:
  • group=categories | series : Specifies how the bars should be grouped along the X-axis. The default is "series" which will group all bars belonging to the same series together (same colors in each group). "category" will group all bars belonging to the same category from different series together (mixed colors in groups).
  • axisline=yes | no : Specifies whether to draw the X-axis as a solid black line. Default is "yes"
  • barwidth=<value>: The width of each bar. This could either be an absolute value in pixels or a percentage value (fraction or number followed by percentage sign)
  • whiskerswidth=<value>: The width of the whiskers. This could either be an absolute value in pixels or a percentage value (fraction or number followed by percentage sign). Default is half or barwidth
  • whiskers=yes | no : Specifies whether or not to draw standard deviation whiskers on top of the bar (if values for SD are provided).
  • doublewhisker=yes | no : If "no", standard deviation whiskers will be drawn as T-shapes on top of the bars (default). If "yes", standard deviation will be drawn as sideways H-shapes extending in both directions.
  • barspacing=<value>: The spacing between each bar given as a decimal number. A spacing of 1.0 is the same as the normal distance between bars (default is 0).
  • groupspacing=<value>: The spacing between each bar group given as a decimal number. A spacing of 1.0 is the same as the normal distance between bars (default is 0).
  • bevel=<value> : A number between -1 and 3 specifying a bevel style for the bar outline. -1=no outline, 0=simple outline (no bevel), 1=thin bevel, 2/3=thick bevel
  • fill=<color> : Controls how the bars are colored inside. Normally, the fill color will be the same as the series color; The setting value could either be a specific color or one of the following keywords:
    • "color": The fill color will be the same as the series color (default)
    • "none": The boxes will not be filled
    • "translucent": The fill color will be a translucent version of the series color
    • "brighter": The fill color will be a brighter non-translucent version of the series color
    • "darker": The fill color will be a darker non-translucent version of the series color
    • "bar": The fill color will be a gradient based on the series color which goes from dark to light and back to dark again in a horizontal direction
    • "vbar": The fill color will be a gradient based on the series color which goes from dark to light and back to dark again in a vertical direction
    • "gradient:N " : The fill color will be a gradient based on the series color going from dark to light in the specified clockwise direction (N should be an integer between 1 and 12)
  • whiskercolor=<color> : Specifies the color to use for drawing whiskers. Normally, the whisker color will be the same as the series color; The setting value could either be a specific color or one of the following keywords:
    • "color": The whisker color will be the same as the series color (default)
    • "translucent": The whisker color will be a translucent version of the series color
    • "brighter": The whisker color will be a brighter non-translucent version of the series color
    • "darker": The whisker color will be a darker non-translucent version of the series color
  • shadow=<offset> : If this distance offset value is greater than 0, the boxes will be drawn with drop-shadows at the specified distance
Box plots:
  • percentiles=0,25,50,75,100 : If this setting is specified, the values should be a comma-separated list of five numbers between 0 and 100 in increasing order specifying respectively the percentile for the bottow whisker, bottom of the box ("1st quartile"), "median", top of the box ("3rd quartile") and top whisker. The actual values corresponding to these percentiles (plus average and SD) will then be derived from the distribution of all the values in the dataset (for each series). Data points below or above the first and last percentiles will be regarded as outliers.
  • plotbox=yes | no : Specifies whether or not to draw the box and whiskers. If you set this to NO you should at least set "average=YES"
  • average=yes | no : Specifies whether or not to draw average and standard deviation on top of the boxplot. Default is NO
  • SD=yes | no : Specifies whether or not to draw angular whiskers for standard deviation when "average=yes"
  • whiskers=yes | no : Specifies whether or not to draw whiskers above and below the box.
  • outliers=yes | no : Specifies whether or not to draw outliers
  • boxwidth=<value>: The width of each box. This could either be an absolute value in pixels or a percentage value (fraction or number followed by percentage sign)
  • whiskerswidth=<value>: The width of the whiskers. This could either be an absolute value in pixels or a percentage value (fraction or number followed by percentage sign)
  • diamondsize=<value>: The size of the diamond shape used to represent the average value
  • point size=<value> : The size of the geometric shape drawn used when drawing outliers (shape is based on series point style)
  • outliercolor=<color> : A separate color to use when drawing outliers (normally these will be drawn in the same color as the different series). This could either be a specific color, or the keywords "brighter", "darker" or "translucent" which will derive a new color based on the series color
  • bevel=<value> : A number between 0 and 3 specifying a bevel style for the box outline. 0=no bevel, 1=thin bevel, 2/3=thick bevel
  • fill=<color> : Controls how the boxes are colored inside. Normally, the boxes will be filled with a translucent version of the series color. The setting value could either be a specific color or one of the following keywords:
    • "none": The boxes will not be filled
    • "translucent": The fill color will be a translucent version of the series color
    • "brighter": The fill color will be a brighter non-translucent version of the series color
    • "darker": The fill color will be a darker non-translucent version of the series color
    • "bar": The fill color will be a gradient based on the series color which goes from dark to light and back to dark again in a horizontal direction
    • "vbar": The fill color will be a gradient based on the series color which goes from dark to light and back to dark again in a vertical direction
    • "gradient:N " : The fill color will be a gradient based on the series color going from dark to light in the specified clockwise direction (N should be an integer between 1 and 12)
  • shadow=<offset> : If this distance offset value is greater than 0, the boxes will be drawn with drop-shadows at the specified distance
Pie charts:
  • border=yes | no : Specifies whether or not to draw a black border around the whole pie chart
  • segmentBorder=yes | no : Specifies whether or not to draw black borders around each segment of the pie
  • bevel=yes | no : Specifies whether or not to draw the pie in a bevelled style (3D)
  • round=yes | no : If "yes" (default) the pie is forced to be perfectly round, else the pie is allowed to stretch to an oval to fit the available width and height of the image
Histogram
  • bins=<value> : The number of equally sized bins to divide the range of values into
Image width The original width of the graph image that will be created (before scaling).
Image height The original height of the graph image that will be created (before scaling).
Image scale A scaling factor for the image. The size of the final image will be [width*scale, height*scale]. An image of size [1200,800] at 100% will have the same final size as an image with size [600,400] at 200% scale, but for the second image all the lines will be twice as thick and the text will be twice as big.

See also: output, Text Variable, Output Data


Plain


The "Plain" format is a basic input/output format that applies to all types of data, but exactly what kind of information is included and the structure of the information will be specific to each data type. The default implementation of the Plain format is to just include the name of the data object itself in the output, and most data types will not override this behaviour since other and more complex data formats are preferred by these data types. However, some data types can use the Plain format to produce sensible output and also read back files in Plain format. For example, for Text Variables and Numeric Variables the output will simply contain the value of the variable. Collection objects will output the names of all data objects included in the collection (one entry per line), Map data objects will output entries in "key=value" format (and can read entries in this format or with the key and value in two TAB-separated columns). Similarly, Partition data objects will output entries as "key=cluster" and can read back the same format (or with key and cluster in two TAB-separated columns).


Arguments
NameDescription
Skip comments This optional parameter can specify a character or text-prefix that denote the beginning of a comment line in the input (e.g. '#' or '//' ). When parsing input in Plain format, all lines that start with the specified prefix will be ignored.

See also: output, Data